Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V011372 | pLenti4/V5-GW/lacZ | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pLenti4/V5-GW/lacZ
- Antibiotic Resistance:
- Ampicillin
- Length:
- 10073 bp
- Type:
- Lentiviral vectors
- Replication origin:
- ori
- Selection Marker:
- Zeocin
- Promoter:
- SV40
- Cloning Method:
- Gateway
- 5' Primer:
- CMVPro Fwd: 5'd[CGCAAATGGGCGGTAGGCGTG]3'
- Fusion Tag:
- V5
pLenti4/V5-GW/lacZ vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pLenti4/V5-GW/lacZ vector Sequence
LOCUS V011372 10073 bp DNA circular SYN 13-JAN-2022
DEFINITION Exported.
ACCESSION V011372
VERSION V011372
KEYWORDS .
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 10073)
TITLE Direct Submission
REFERENCE 2 (bases 1 to 10073)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..10073
/mol_type="other DNA"
/organism="synthetic DNA construct"
protein_bind complement(811..835)
/label="attB2"
/note="recombination site for the Gateway(R) BP reaction"
CDS 888..929
/label="V5 tag"
/note="epitope tag from simian virus 5"
promoter 971..1300
/label="SV40 promoter"
/note="SV40 enhancer and early promoter"
promoter 1312..1359
/label="EM7 promoter"
/note="synthetic bacterial promoter"
CDS 1378..1749
/label="BleoR"
/note="antibiotic-binding protein"
LTR 1845..2078
/label="3' LTR (Delta-U3)"
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 2150..2284
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
rep_origin 2311..2446
/label="SV40 ori"
/note="SV40 origin of replication"
promoter complement(2467..2485)
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
rep_origin 2653..3108
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 3134..3238
/label="AmpR promoter"
CDS 3239..4096
/label="AmpR"
/note="beta-lactamase"
rep_origin 4270..4858
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
protein_bind 5146..5167
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
promoter 5182..5212
/label="lac promoter"
/note="promoter for the E. coli lac operon"
promoter 5281..5299
/label="T3 promoter"
/note="promoter for bacteriophage T3 RNA polymerase"
promoter 5327..5553
/label="RSV promoter"
/note="Rous sarcoma virus enhancer/promoter"
misc_feature 5781..5906
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 6399..6632
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 6817..6861
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 7010..7051
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
enhancer 7140..7443
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 7444..7647
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
protein_bind 7764..7788
/label="attB1"
/note="recombination site for the Gateway(R) BP reaction"
CDS join(7820..10073,1..791)
/label="lacZ"
/note="beta-galactosidase"