pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1 vector (V000690)

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V000690 pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1 In stock, 1 week for quality controls

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1
Antibiotic Resistance:
Ampicillin
Length:
9431 bp
Type:
Mammalian Expression, Lentiviral
Replication origin:
ori
Copy Number:
High Copy
Promoter:
U6
Cloning Method:
Restriction Enzyme
5' Primer:
agctggtttagtgaaccgtcagatc
3' Primer:
ggaaccggaacccttaaaca

pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1 vector Map

pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon19431 bp400800120016002000240028003200360040004400480052005600600064006800720076008000840088009200IRESHistone H1.0mMaroon1loxPWPREKS primer5' LTR (truncated)oriAmpRAmpR promoterCMV enhancerCMV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSU6 promoterKS primerloxPCMV enhancerCMV promotermTurquoise2IRES2

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1 vector Sequence

LOCUS       V000690                 9431 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V000690
VERSION     V000690
KEYWORDS    pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 9431)
  AUTHORS   Bajar BT, Lam AJ, Badiee RK, Oh YH, Chu J, Zhou XX, Kim N, Kim BB,
            Chung M, Yablonovitch AL, Cruz BF, Kulalert K, Tao JJ, Meyer T, Su
            XD, Lin MZ
  TITLE     Fluorescent indicators for simultaneous reporting of all four cell
            cycle phases.
  JOURNAL   Nat Methods. 2016 Oct 31. doi: 10.1038/nmeth.4045.
   PUBMED   27798610
REFERENCE   2  (bases 1 to 9431)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 9431)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Nat
            Methods. 2016 Oct 31. doi: 10.1038/nmeth.4045."
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..9431
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     misc_feature    13..563
                     /label="IRES"
                     /note="internal ribosome entry site (IRES) of the
                     encephalomyocarditis virus (EMCV)"
     CDS             577..1158
                     /gene="H1-0"
                     /label="Histone H1.0"
                     /note="Histone H1.0 from Mus musculus. Accession#: P10922"
     CDS             1189..1899
                     /label="mMaroon1"
                     /note="bright, rapidly maturing, monomeric far-red
                     fluorescent protein (Bajar et al., 2016)"
     protein_bind    1930..1963
                     /label="loxP"
                     /bound_moiety="Cre recombinase"
                     /note="Cre-mediated recombination occurs in the 8-bp core
                     sequence (GCATACAT)."
     misc_feature    2019..2607
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     primer_bind     complement(2610..2626)
                     /label="KS primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     LTR             2849..3029
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     rep_origin      complement(3091..3679)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(3853..4710)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(4711..4815)
                     /label="AmpR promoter"
     enhancer        4906..5209
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        5211..5409
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     LTR             5427..5607
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    5654..5779
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    6276..6509
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             6694..6738
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             6887..6928
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    7036..7153
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        7212..7524
                     /label="U6 promoter"
                     /note="RNA polymerase III promoter for mouse U6 snRNA (Das
                     et al., 1988)"
     primer_bind     7541..7557
                     /label="KS primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     protein_bind    complement(7599..7632)
                     /label="loxP"
                     /note="Cre-mediated recombination occurs in the 8-bp core
                     sequence (ATGTATGC) (Shaw et al., 2021)."
     enhancer        7748..8051
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        8052..8255
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     CDS             8291..9007
                     /label="mTurquoise2"
                     /note="enhanced monomeric variant of CFP (Goedhart et al.,
                     2012)"
     misc_feature    9421..9431
                     /label="IRES2"
                     /note="internal ribosome entry site (IRES) of the
                     encephalomyocarditis virus (EMCV)"