Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V000690 | pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1 | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1
- Antibiotic Resistance:
- Ampicillin
- Length:
- 9431 bp
- Type:
- Mammalian Expression, Lentiviral
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- U6
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- agctggtttagtgaaccgtcagatc
- 3' Primer:
- ggaaccggaacccttaaaca
pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1 vector Vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1 vector Sequence
LOCUS V000690 9431 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V000690
VERSION V000690
KEYWORDS pLL3.7m-mTurquoise2-SLBP(18-126)-IRES-H1-mMaroon1
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 9431)
AUTHORS Bajar BT, Lam AJ, Badiee RK, Oh YH, Chu J, Zhou XX, Kim N, Kim BB,
Chung M, Yablonovitch AL, Cruz BF, Kulalert K, Tao JJ, Meyer T, Su
XD, Lin MZ
TITLE Fluorescent indicators for simultaneous reporting of all four cell
cycle phases.
JOURNAL Nat Methods. 2016 Oct 31. doi: 10.1038/nmeth.4045.
PUBMED 27798610
REFERENCE 2 (bases 1 to 9431)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 9431)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Nat
Methods. 2016 Oct 31. doi: 10.1038/nmeth.4045."
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..9431
/mol_type="other DNA"
/organism="synthetic DNA construct"
misc_feature 13..563
/label="IRES"
/note="internal ribosome entry site (IRES) of the
encephalomyocarditis virus (EMCV)"
CDS 577..1158
/gene="H1-0"
/label="Histone H1.0"
/note="Histone H1.0 from Mus musculus. Accession#: P10922"
CDS 1189..1899
/label="mMaroon1"
/note="bright, rapidly maturing, monomeric far-red
fluorescent protein (Bajar et al., 2016)"
protein_bind 1930..1963
/label="loxP"
/bound_moiety="Cre recombinase"
/note="Cre-mediated recombination occurs in the 8-bp core
sequence (GCATACAT)."
misc_feature 2019..2607
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
primer_bind complement(2610..2626)
/label="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
LTR 2849..3029
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
rep_origin complement(3091..3679)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(3853..4710)
/label="AmpR"
/note="beta-lactamase"
promoter complement(4711..4815)
/label="AmpR promoter"
enhancer 4906..5209
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 5211..5409
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 5427..5607
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 5654..5779
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 6276..6509
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 6694..6738
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 6887..6928
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 7036..7153
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 7212..7524
/label="U6 promoter"
/note="RNA polymerase III promoter for mouse U6 snRNA (Das
et al., 1988)"
primer_bind 7541..7557
/label="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
protein_bind complement(7599..7632)
/label="loxP"
/note="Cre-mediated recombination occurs in the 8-bp core
sequence (ATGTATGC) (Shaw et al., 2021)."
enhancer 7748..8051
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 8052..8255
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
CDS 8291..9007
/label="mTurquoise2"
/note="enhanced monomeric variant of CFP (Goedhart et al.,
2012)"
misc_feature 9421..9431
/label="IRES2"
/note="internal ribosome entry site (IRES) of the
encephalomyocarditis virus (EMCV)"