Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V000697 | pLH-sgRNA1 | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pLH-sgRNA1
- Antibiotic Resistance:
- Ampicillin
- Length:
- 8267 bp
- Type:
- Mammalian Expression, Lentiviral, CRISPR
- Replication origin:
- ori
- Selection Marker:
- Hygromycin
- Copy Number:
- High Copy
- Promoter:
- hPGK
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- cccttcaccgagggcctatttccc
- 3' Primer:
- CTATTCTTTCCCCTGCACTGTACCC
pLH-sgRNA1 vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pLH-sgRNA1 vector Sequence
LOCUS V000697 8267 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V000697
VERSION V000697
KEYWORDS pLH-sgRNA1
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 8267)
AUTHORS Ma H, Tu LC, Naseri A, Huisman M, Zhang S, Grunwald D, Pederson T
TITLE Multiplexed labeling of genomic loci with dCas9 and engineered
sgRNAs using CRISPRainbow.
JOURNAL Nat Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526.
PUBMED 27088723
REFERENCE 2 (bases 1 to 8267)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 8267)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Nat
Biotechnol. 2016 Apr 18. doi: 10.1038/nbt.3526."
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..8267
/mol_type="other DNA"
/organism="synthetic DNA construct"
protein_bind 51..72
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
promoter 87..117
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind 125..141
/label="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
primer_bind 149..165
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
promoter 186..204
/label="T3 promoter"
/note="promoter for bacteriophage T3 RNA polymerase"
promoter 232..458
/label="RSV promoter"
/note="Rous sarcoma virus enhancer/promoter"
LTR 459..639
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 686..811
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1304..1537
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 1722..1766
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 1915..1956
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
promoter 2064..2304
/label="U6 promoter"
/note="RNA polymerase III promoter for human U6 snRNA"
CDS 2653..2955
/label="ccdB"
/note="CcdB, a bacterial toxin that poisons DNA gyrase"
misc_RNA 2979..3054
/label="gRNA scaffold"
/note="guide RNA scaffold for the Streptococcus pyogenes
CRISPR/Cas9 system"
misc_feature 3103..3220
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 3269..3779
/label="hPGK promoter"
/note="human phosphoglycerate kinase 1 promoter"
CDS 3869..4891
/label="HygR"
/note="aminoglycoside phosphotransferase from E. coli"
primer_bind complement(4918..4934)
/label="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
LTR 5017..5250
/label="3' LTR (Delta-U3)"
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 5322..5456
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
rep_origin 5483..5618
/label="SV40 ori"
/note="SV40 origin of replication"
promoter complement(5639..5657)
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
primer_bind complement(5667..5683)
/label="M13 fwd"
/note="common sequencing primer, one of multiple similar
variants"
rep_origin 5825..6280
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 6306..6410
/label="AmpR promoter"
CDS 6411..7268
/label="AmpR"
/note="beta-lactamase"
rep_origin 7442..8030
/direction=RIGHT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
primer_bind 8184..8201
/label="L4440"
/note="L4440 vector, forward primer"