pHAGE EF1α dCas9-VP64 vector (V000725)

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V000725 pHAGE EF1α dCas9-VP64 In stock, 1 week for quality controls

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pHAGE EF1α dCas9-VP64
Antibiotic Resistance:
Ampicillin
Length:
12794 bp
Type:
Mammalian Expression, Lentiviral, CRISPR
Replication origin:
ori
Selection Marker:
Puromycin
Copy Number:
High Copy
Promoter:
EF-1α
Cloning Method:
Gateway Cloning
5' Primer:
AGAGCTCGTTTAGTGAACCG
3' Primer:
MSCV-rev

pHAGE EF1α dCas9-VP64 vector Map

pHAGE EF1α dCas9-VP6412794 bp6001200180024003000360042004800540060006600720078008400900096001020010800114001200012600HAPGK promoterPuroRWPRE3' LTR (Delta-U3)pBRforEcoAmpR promoterAmpRoriL4440SV40pro-FCAP binding sitelac promoterM13/pUC ReverseEBV-rev3' LTRHIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSEF-1-alpha promoterattB1dCas9SV40 NLS3xHAVP64

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pHAGE EF1α dCas9-VP64 vector Sequence

LOCUS       V000725                12794 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V000725
VERSION     V000725
KEYWORDS    pHAGE EF1-alpha dCas9-VP64
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 12794)
  AUTHORS   Kearns NA, Genga RM, Enuameh MS, Garber M, Wolfe SA, Maehr R
  TITLE     Cas9 effector-mediated regulation of transcription and
            differentiation in human pluripotent stem cells.
  JOURNAL   Development. 2014 Jan;141(1):219-23. doi: 10.1242/dev.103341.
   PUBMED   24346702
REFERENCE   2  (bases 1 to 12794)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 12794)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi: "10.1242/dev";
            journalName: "Development"; date: "2014-01"; volume: "141"; issue:
            "1"; pages: "219-23"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..12794
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     CDS             67..93
                     /label="HA"
                     /note="HA (human influenza hemagglutinin) epitope tag"
     promoter        126..625
                     /label="PGK promoter"
                     /note="mouse phosphoglycerate kinase 1 promoter"
     CDS             646..1242
                     /label="PuroR"
                     /note="puromycin N-acetyltransferase"
     misc_feature    1262..1850
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     LTR             1925..2158
                     /label="3' LTR (Delta-U3)"
                     /note="self-inactivating 3' long terminal repeat (LTR) from
                     HIV-1"
     primer_bind     complement(2277..2295)
                     /label="pBRforEco"
                     /note="pBR322 vectors, upsteam of EcoRI site, forward
                     primer"
     promoter        2363..2467
                     /label="AmpR promoter"
     CDS             2468..3325
                     /label="AmpR"
                     /note="beta-lactamase"
     rep_origin      3499..4087
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     primer_bind     4241..4258
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     primer_bind     4350..4369
                     /label="SV40pro-F"
                     /note="SV40 promoter/origin, forward primer"
     protein_bind    4498..4519
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     promoter        4534..4564
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    4572..4588
                     /label="lac operator"
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     primer_bind     4577..4599
                     /label="M13/pUC Reverse"
                     /note="In lacZ gene"
     primer_bind     4596..4612
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     primer_bind     4596..4612
                     /label="M13 Reverse"
                     /note="In lacZ gene. Also called M13-rev"
     primer_bind     4662..4681
                     /label="EBV-rev"
                     /note="SV40 polyA terminator, reverse primer"
     LTR             4873..5506
                     /label="3' LTR"
                     /note="3' long terminal repeat (LTR) from HIV-1"
     misc_feature    5553..5678
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    6175..6408
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             6593..6637
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             6786..6827
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    6930..7047
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        7093..8271
                     /label="EF-1-alpha promoter"
                     /note="strong constitutive promoter for human elongation
                     factor EF-1-alpha"
     protein_bind    8306..8330
                     /gene="mutant version of attB"
                     /label="attB1"
                     /bound_moiety="BP Clonase(TM)"
                     /note="recombination site for the Gateway(R) BP reaction"
     CDS             8340..12443
                     /label="dCas9"
                     /note="catalytically dead mutant of the Cas9 endonuclease
                     from the Streptococcus pyogenes Type II CRISPR/Cas system"
     CDS             12456..12476
                     /codon_start=1
                     /product="nuclear localization signal of SV40 (simian virus
                     40) large T antigen"
                     /label="SV40 NLS"
                     /translation="PKKKRKV"
     CDS             12477..12566
                     /label="3xHA"
                     /note="three tandem HA epitope tags"
     CDS             12588..12737
                     /label="VP64"
                     /note="tetrameric repeat of the minimal activation domain
                     of herpes simplex virus VP16 (Beerli et al., 1998)"