Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V000732 | pCRISPRia-v2 | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pCRISPRia-v2
- Antibiotic Resistance:
- Ampicillin
- Length:
- 8893 bp
- Type:
- Mammalian Expression, Lentiviral, CRISPR
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Copy Number:
- High Copy
- Promoter:
- EF-1α
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- gcgccaattctgcagacaaa
- 3' Primer:
- CCTTCTCTAGGCACCGGTTC
pCRISPRia-v2 vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pCRISPRia-v2 vector Sequence
LOCUS V000732 8893 bp DNA circular SYN 20-DEC-2021
DEFINITION Exported.
ACCESSION V000732
VERSION V000732
KEYWORDS pCRISPRia-v2
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 8893)
AUTHORS Horlbeck MA, Gilbert LA, Villalta JE, Adamson B, Pak RA, Chen Y,
Fields AP, Park CY, Corn JE, Kampmann M, Weissman JS
TITLE Compact and highly active next-generation libraries for
CRISPR-mediated gene repression and activation.
JOURNAL Elife. 2016 Sep 23;5. pii: e19760. doi: 10.7554/eLife.19760.
PUBMED 27661255
REFERENCE 2 (bases 1 to 8893)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 8893)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Elife.";
date: "2016-09-23"; pages: "
10.7554/eLife.19760"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..8893
/mol_type="other DNA"
/organism="synthetic DNA construct"
misc_feature 293..526
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 711..755
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 904..945
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 1053..1170
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
protein_bind 1431..1464
/label="loxP"
/bound_moiety="Cre recombinase"
/note="Cre-mediated recombination occurs in the 8-bp core
sequence (GCATACAT)."
primer_bind 1468..1488
/label="mU6-F"
/note="Mouse U6 promoter, forward primer"
promoter 1728..2900
/label="EF-1-alpha promoter"
/note="strong constitutive promoter for human elongation
factor EF-1-alpha"
CDS 2912..3508
/label="PuroR"
/note="puromycin N-acetyltransferase"
CDS 3518..3571
/codon_start=1
/product="2A peptide from Thosea asigna virus capsid
protein"
/label="T2A"
/note="Eukaryotic ribosomes fail to insert a peptide bond
between the Gly and Pro residues, yielding separate
polypeptides."
/translation="EGRGSLLTCGDVEENPGP"
CDS 3584..4279
/label="TagBFP"
/note="monomeric blue fluorescent protein"
protein_bind complement(4302..4335)
/label="loxP"
/note="Cre-mediated recombination occurs in the 8-bp core
sequence (ATGTATGC) (Shaw et al., 2021)."
misc_feature 4391..4979
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
primer_bind complement(4982..4998)
/label="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
LTR 5508..5688
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
rep_origin complement(5750..6338)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(6512..7369)
/label="AmpR"
/note="beta-lactamase"
promoter complement(7370..7474)
/label="AmpR promoter"
primer_bind complement(7549..7568)
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"
enhancer 7740..8119
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 8120..8322
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 8337..8517
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 8564..8689
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"