Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V000763 | LentiCRISPRv2GFP | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- LentiCRISPRv2GFP
- Antibiotic Resistance:
- Ampicillin
- Length:
- 13131 bp
- Type:
- Lentiviral, CRISPR
- Replication origin:
- ori
- Promoter:
- SV40
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- ATGGTGTCTAAGGGCGAAGA
LentiCRISPRv2GFP vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
LentiCRISPRv2GFP vector Sequence
LOCUS V000763 13131 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V000763
VERSION V000763
KEYWORDS LentiCRISPRv2GFP
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 13131)
AUTHORS Walter DM, Venancio OS, Buza EL, Tobias JW, Deshpande C, Gudiel AA,
Kim-Kiselak C, Cicchini M, Yates TJ, Feldser DM
TITLE Systematic in vivo inactivation of chromatin regulating enzymes
identifies Setd2 as a potent tumor suppressor in lung
adenocarcinoma.
JOURNAL Cancer Res. 2017 Feb 15. pii: canres.2159.2016. doi:
10.1158/0008-5472.CAN-16-2159.
PUBMED 28202515
REFERENCE 2 (bases 1 to 13131)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 13131)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Cancer Res.
2017 Feb 15. pii: canres.2159.2016. doi:
10.1158/0008-5472.CAN-16-2159."
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..13131
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter 1..241
/label="U6 promoter"
/note="RNA polymerase III promoter for human U6 snRNA"
misc_RNA 266..341
/label="gRNA scaffold"
/note="guide RNA scaffold for the Streptococcus pyogenes
CRISPR/Cas9 system"
promoter 403..614
/label="EF-1-alpha core promoter"
/note="core promoter for human elongation factor
EF-1-alpha"
CDS 639..4742
/label="Cas9"
/note="Cas9 (Csn1) endonuclease from the Streptococcus
pyogenes Type II CRISPR/Cas system"
CDS 4743..4790
/codon_start=1
/product="bipartite nuclear localization signal from
nucleoplasmin"
/label="nucleoplasmin NLS"
/translation="KRPAATKKAGQAKKKK"
CDS 4791..4814
/label="FLAG"
/note="FLAG(R) epitope tag, followed by an enterokinase
cleavage site"
CDS 4824..4880
/codon_start=1
/product="2A peptide from porcine teschovirus-1
polyprotein"
/label="P2A"
/note="Eukaryotic ribosomes fail to insert a peptide bond
between the Gly and Pro residues, yielding separate
polypeptides."
/translation="ATNFSLLKQAGDVEENPGP"
CDS 4881..5597
/label="EGFP"
/note="enhanced GFP"
misc_feature 5616..6204
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
LTR 6276..6509
/label="3' LTR (Delta-U3)"
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
polyA_signal 6541..6765
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
rep_origin 6811..7239
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 7253..7582
/label="SV40 promoter"
/note="SV40 enhancer and early promoter"
promoter 7630..7677
/label="EM7 promoter"
/note="synthetic bacterial promoter"
CDS 7696..8067
/label="BleoR"
/note="antibiotic-binding protein"
polyA_signal 8200..8333
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
primer_bind complement(8370..8386)
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(8370..8386)
/label="M13 Reverse"
/note="In lacZ gene. Also called M13-rev"
primer_bind complement(8383..8405)
/label="M13/pUC Reverse"
/note="In lacZ gene"
protein_bind 8394..8410
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(8418..8448)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(8463..8484)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
primer_bind complement(8601..8618)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(8772..9360)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(9534..10391)
/label="AmpR"
/note="beta-lactamase"
promoter complement(10392..10496)
/label="AmpR promoter"
primer_bind complement(10571..10590)
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"
enhancer 10762..11141
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 11142..11344
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 11359..11539
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 11586..11711
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 12204..12437
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 12622..12666
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 12815..12856
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 12964..13081
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"