Price Information
| Cat No. | Plasmid Name | Availability | Buy one, get one free! (?) |
|---|---|---|---|
| V000855 | pXR001: EF1a-CasRx-2A-EGFP | In stock, 1 week for quality controls |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pXR001: EF1a-CasRx-2A-EGFP
- Antibiotic Resistance:
- Ampicillin
- Length:
- 12991 bp
- Type:
- Mammalian Expression, Lentiviral, CRISPR
- Replication origin:
- ori
- Selection Marker:
- GFP
- Copy Number:
- High Copy
- Promoter:
- EF-1α
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- ggatcttggttcattctcaagcctc
pXR001: EF1a-CasRx-2A-EGFP vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pXR001: EF1a-CasRx-2A-EGFP vector Sequence
LOCUS V000855 12991 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V000855
VERSION V000855
KEYWORDS pXR001: EF1a-CasRx-2A-EGFP
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 12991)
AUTHORS Konermann S, Lotfy P, Brideau NJ, Oki J, Shokhirev MN, Hsu PD
TITLE Transcriptome Engineering with RNA-Targeting Type VI-D CRISPR
Effectors.
JOURNAL Cell. 2018 Mar 8. pii: S0092-8674(18)30207-1. doi:
10.1016/j.cell.2018.02.033.
PUBMED 29551272
REFERENCE 2 (bases 1 to 12991)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 12991)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Cell. 2018
Mar 8. pii: S0092-8674(18)30207-1. doi: 10.1016/j.cell.2018.02.033."
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..12991
/mol_type="other DNA"
/organism="synthetic DNA construct"
misc_feature 61..178
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 303..1481
/label="EF-1-alpha promoter"
/note="strong constitutive promoter for human elongation
factor EF-1-alpha"
CDS 1500..1520
/label="SV40 NLS"
/note="nuclear localization signal of SV40 (simian virus
40) large T antigen"
CDS 1530..4427
/label="RfxCas13d"
/note="RNA-targeting Type VI CRISPR protein from
Ruminococcus flavefaciens strain XPD3002 (Konermann et al.,
2018)"
CDS 4437..4457
/label="SV40 NLS"
/note="nuclear localization signal of SV40 (simian virus
40) large T antigen"
CDS 4467..4493
/label="HA"
/note="HA (human influenza hemagglutinin) epitope tag"
CDS 4509..4562
/codon_start=1
/product="2A peptide from Thosea asigna virus capsid
protein"
/label="T2A"
/note="Eukaryotic ribosomes fail to insert a peptide bond
between the Gly and Pro residues, yielding separate
polypeptides."
/translation="EGRGSLLTCGDVEENPGP"
CDS 4563..5276
/label="EGFP"
/note="enhanced GFP"
misc_feature 5304..5892
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
primer_bind complement(5895..5911)
/label="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(5896..5912)
/label="pBluescriptKS"
/note="For pBluescript vector"
LTR 6417..6597
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
polyA_signal 6629..6853
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
rep_origin 6899..7327
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 7341..7670
/label="SV40 promoter"
/note="SV40 enhancer and early promoter"
promoter 7718..7765
/label="EM7 promoter"
/note="synthetic bacterial promoter"
CDS 7784..8155
/label="BleoR"
/note="antibiotic-binding protein"
polyA_signal 8288..8421
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
primer_bind complement(8458..8474)
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(8458..8474)
/label="M13 Reverse"
/note="In lacZ gene. Also called M13-rev"
primer_bind complement(8471..8493)
/label="M13/pUC Reverse"
/note="In lacZ gene"
protein_bind 8482..8498
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(8506..8536)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(8551..8572)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
primer_bind complement(8689..8706)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(8860..9448)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(9622..10479)
/label="AmpR"
/note="beta-lactamase"
promoter complement(10480..10584)
/label="AmpR promoter"
primer_bind complement(10659..10678)
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"
enhancer 10850..11229
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 11230..11432
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 11447..11627
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 11674..11799
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 12292..12525
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 12710..12754
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 12903..12944
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"