Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V000862 | pLgw EcoDam-V5-RFC1 | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pLgw EcoDam-V5-RFC1
- Antibiotic Resistance:
- Chloramphenicol, Ampicillin
- Length:
- 10221 bp
- Type:
- Mammalian Expression, Lentiviral ; DamID
- Replication origin:
- ori
- Selection Marker:
- Zeo marker is outside the LTRs and will not be packaged into virus.
- Promoter:
- hsp70
- Cloning Method:
- Gateway Cloning
- 5' Primer:
- pCasper-hs (GCAACTACTGAAATCTGCCAAG)
pLgw EcoDam-V5-RFC1 vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pLgw EcoDam-V5-RFC1 vector Sequence
LOCUS V000862 10221 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V000862
VERSION V000862
KEYWORDS pLgw EcoDam-V5-RFC1
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 10221)
AUTHORS Vogel MJ, Guelen L, de Wit E, Peric-Hupkes D, Loden M, Talhout W,
Feenstra M, Abbas B, Classen AK, van Steensel B
TITLE Human heterochromatin proteins form large domains containing
KRAB-ZNF genes.
JOURNAL Genome Res. 2006 Dec;16(12):1493-504. Epub 2006 Oct 12.
PUBMED 17038565
REFERENCE 2 (bases 1 to 10221)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 10221)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Genome
Res."; date: "2006-12"; volume: "16(12)"; pages: "1493-504. Epub
2006 Oct 12"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..10221
/mol_type="other DNA"
/organism="synthetic DNA construct"
primer_bind complement(44..63)
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"
enhancer 235..614
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 615..817
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 832..1012
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 1056..1181
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1674..1907
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 2092..2136
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2285..2326
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
promoter 2598..2836
/label="hsp70 promoter"
/note="Drosophila melanogaster hsp70Bb promoter"
CDS 2891..3724
/gene="dam"
/label="DNA adenine methylase"
/note="DNA adenine methylase from Escherichia coli (strain
K12). Accession#: P0AEE8"
CDS 3731..3772
/label="V5 tag"
/note="epitope tag from simian virus 5"
protein_bind 3788..3911
/label="attR1"
/note="recombination site for the Gateway(R) LR reaction"
promoter 3937..3967
/label="lac UV5 promoter"
/note="E. coli lac promoter with an 'up' mutation"
CDS 4021..4698
/label="CmR"
/note="chloramphenicol acetyltransferase"
CDS 5021..5323
/label="ccdB"
/note="CcdB, a bacterial toxin that poisons DNA gyrase"
protein_bind complement(5367..5491)
/label="attR2"
/note="recombination site for the Gateway(R) LR reaction"
LTR 6022..6202
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
polyA_signal 6234..6458
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
rep_origin 6504..6932
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 6946..7276
/label="SV40 promoter"
/note="SV40 enhancer and early promoter"
promoter 7324..7371
/label="EM7 promoter"
/note="synthetic bacterial promoter"
CDS 7390..7761
/label="BleoR"
/note="antibiotic-binding protein"
polyA_signal 7894..8027
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
primer_bind complement(8064..8080)
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind complement(8064..8080)
/label="M13 Reverse"
/note="In lacZ gene. Also called M13-rev"
primer_bind complement(8077..8099)
/label="M13/pUC Reverse"
/note="In lacZ gene"
protein_bind 8088..8104
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(8112..8142)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(8157..8178)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
primer_bind complement(8295..8312)
/label="L4440"
/note="L4440 vector, forward primer"
rep_origin complement(8466..9054)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(9228..10085)
/label="AmpR"
/note="beta-lactamase"
promoter complement(10086..10190)
/label="AmpR promoter"