Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V000912 | pGEN-luxCDABE | In stock, instant shipping |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pGEN-luxCDABE
- Antibiotic Resistance:
- Ampicillin
- Length:
- 11109 bp
- Type:
- Luciferase
- Replication origin:
- p15A ori
- Copy Number:
- Low Copy
- Promoter:
- EM7
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- CATATGAAGCTTGGTACCGGGATC
- 3' Primer:
- CTTTCGGGAAAGATTTCAACCTGG
- Growth Strain(s):
- DH10B
- Growth Temperature:
- 37℃
pGEN-luxCDABE vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pGEN-luxCDABE vector Sequence
LOCUS V000912 11109 bp DNA circular SYN 13-MAY-2021 DEFINITION Exported. ACCESSION V000912 VERSION V000912 KEYWORDS pGEN-luxCDABE SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 11109) AUTHORS Lane MC, Alteri CJ, Smith SN, Mobley HL TITLE Expression of flagella is coincident with uropathogenic Escherichia coli ascension to the upper urinary tract. JOURNAL Proc Natl Acad Sci U S A. 2007 Oct 16;104(42):16669-74. Epub 2007 Oct 9. PUBMED 17925449 REFERENCE 2 (bases 1 to 11109) TITLE Direct Submission REFERENCE 3 (bases 1 to 11109) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Proc Natl Acad Sci U S A."; date: "2007-10-16"; volume: "104(42)"; pages: "16669-74. Epub 2007 Oct 9" SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..11109 /mol_type="other DNA" /organism="synthetic DNA construct" promoter 887..934 /label="EM7 promoter" /note="synthetic bacterial promoter" CDS 1021..2460 /label="LuxC" /note="LuxC fatty acid reductase" CDS 2476..3396 /label="LuxD" /note="LuxD acyltransferase" CDS 3448..4527 /label="LuxA" /note="LuxA luciferase subunit" CDS 4545..5525 /label="LuxB" /note="LuxB luciferase subunit" CDS 5707..6816 /label="LuxE" /note="LuxE" rep_origin complement(7074..7619) /direction=LEFT /label="p15A ori" /note="Plasmids containing the medium-copy-number p15A origin of replication can be propagated in E. coli cells that contain a second plasmid with the ColE1 origin." terminator complement(7783..7869) /label="rrnB T1 terminator" /note="transcription terminator T1 from the E. coli rrnB gene" CDS complement(8587..9444) /label="AmpR" /note="beta-lactamase" promoter complement(9445..9549) /label="AmpR promoter" CDS join(10466..11109,1..268) /gene="parM" /label="Plasmid segregation protein ParM" /note="Plasmid segregation protein ParM from Escherichia coli. Accession#: P11904"