pGEN-luxCDABE vector (V000912)

Price Information

Cat No.	Plasmid Name	Availability	Add to cart
V000912	pGEN-luxCDABE	In stock, instant shipping	Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:: pGEN-luxCDABE

Antibiotic Resistance:: Ampicillin

Length:: 11109 bp

Type:: Luciferase

Replication origin:: p15A ori

Copy Number:: Low Copy

Promoter:: EM7

Cloning Method:: Restriction Enzyme

5' Primer:: CATATGAAGCTTGGTACCGGGATC

3' Primer:: CTTTCGGGAAAGATTTCAACCTGG

Growth Strain(s):: DH10B

Growth Temperature:: 37℃

pGEN-luxCDABE vector Vector Map

View Map in NovoBuilder

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pGEN-luxCDABE vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       V000912                11109 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V000912
VERSION     V000912
KEYWORDS    pGEN-luxCDABE
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 11109)
  AUTHORS   Lane MC, Alteri CJ, Smith SN, Mobley HL
  TITLE     Expression of flagella is coincident with uropathogenic Escherichia
            coli ascension to the upper urinary tract.
  JOURNAL   Proc Natl Acad Sci U S A. 2007 Oct 16;104(42):16669-74. Epub 2007
            Oct 9.
   PUBMED   17925449
REFERENCE   2  (bases 1 to 11109)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 11109)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Proc Natl
            Acad Sci U S A."; date: "2007-10-16"; volume: "104(42)"; pages:
            "16669-74. Epub 2007 Oct 9"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..11109
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        887..934
                     /label="EM7 promoter"
                     /note="synthetic bacterial promoter"
     CDS             1021..2460
                     /label="LuxC"
                     /note="LuxC fatty acid reductase"
     CDS             2476..3396
                     /label="LuxD"
                     /note="LuxD acyltransferase"
     CDS             3448..4527
                     /label="LuxA"
                     /note="LuxA luciferase subunit"
     CDS             4545..5525
                     /label="LuxB"
                     /note="LuxB luciferase subunit"
     CDS             5707..6816
                     /label="LuxE"
                     /note="LuxE"
     rep_origin      complement(7074..7619)
                     /direction=LEFT
                     /label="p15A ori"
                     /note="Plasmids containing the medium-copy-number p15A
                     origin of replication can be propagated in E. coli cells
                     that contain a second plasmid with the ColE1 origin."
     terminator      complement(7783..7869)
                     /label="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
                     gene"
     CDS             complement(8587..9444)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(9445..9549)
                     /label="AmpR promoter"
     CDS             join(10466..11109,1..268)
                     /gene="parM"
                     /label="Plasmid segregation protein ParM"
                     /note="Plasmid segregation protein ParM from Escherichia
                     coli. Accession#: P11904"