Cart 2

pMXspuro-GFP vector (V001043)

Price Information

Cat No. Plasmid Name Availability Add to cart
V001043 pMXspuro-GFP In stock, 1 week for quality controls

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pMXspuro-GFP
Antibiotic Resistance:
Ampicillin
Length:
6344 bp
Type:
Mammalian Expression, Retroviral
Replication origin:
ori
Selection Marker:
Puromycin
Copy Number:
High Copy
Promoter:
SV40
Cloning Method:
Restriction Enzyme
5' Primer:
GACGGCATCGCAGCTTGGATACAC

pMXspuro-GFP vector Map

pMXspuro-GFP6344 bp300600900120015001800210024002700300033003600390042004500480051005400570060006300pol regionEGFPSV40 promoterPuroRLTRL4440oriAmpRAmpR promoterlong terminal repeat from Moloney murine leukemiavirusMMLV Psigag (truncated)

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pMXspuro-GFP vector Sequence

Copy Sequence

Download GenBank File(.gb)

LOCUS       pMXspuro-GFP.        6344 bp DNA     circular SYN 13-MAY-2021
DEFINITION  Retroviral control vector containing GFP insert.
ACCESSION   .
VERSION     .
KEYWORDS    pMXspuro-GFP
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
REFERENCE   1  (bases 1 to 6344)
  AUTHORS   Kenific CM, Stehbens SJ, Goldsmith J, Leidal AM, Faure N, Ye J, 
            Wittmann T, Debnath J
  TITLE     NBR1 enables autophagy-dependent focal adhesion turnover.
  JOURNAL   J Cell Biol. 2016 Feb 29;212(5):577-590. Epub 2016 Feb 22.
  PUBMED    26903539
REFERENCE   2  (bases 1 to 6344)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 6344)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "J Cell
            Biol."; date: "2016-02-29"; volume: "212(5)"; pages: "577-590. Epub
            2016 Feb 22"
COMMENT     SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..6344
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     misc_feature    1..375
                     /label=pol region
                     /note="Moloney murine leukemia virus (MMLV) pol region 
                     containing the splice acceptor site"
     CDS             407..1123
                     /label=EGFP
                     /note="enhanced GFP"
     promoter        1165..1494
                     /label=SV40 promoter
                     /note="SV40 enhancer and early promoter"
     CDS             1504..2100
                     /label=PuroR
                     /note="puromycin N-acetyltransferase"
     LTR             2208..2799
                     /label=LTR
                     /note="long terminal repeat from Moloney murine leukemia
                     virus"
     primer_bind     complement(2929..2946)
                     /label=L4440
                     /note="L4440 vector, forward primer"
     rep_origin      complement(3100..3688)
                     /direction=LEFT
                     /label=ori
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of 
                     replication"
     CDS             complement(3855..4712)
                     /label=AmpR
                     /note="beta-lactamase"
     promoter        complement(4713..4817)
                     /label=AmpR promoter
     LTR             4847..5440
                     /note="long terminal repeat from Moloney murine leukemia
                     virus"
     misc_feature    5503..5860
                     /label=MMLV Psi
                     /note="packaging signal of Moloney murine leukemia virus
                     (MMLV)"
     CDS             5919..6335
                     /label=gag (truncated)
                     /note="truncated Moloney murine leukemia virus (MMLV) gag
                     gene lacking the start codon"