Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V001083 | pSIN4-EF1a-LMO2-IRES-Puro | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pSIN4-EF1a-LMO2-IRES-Puro
- Antibiotic Resistance:
- Ampicillin
- Length:
- 8044 bp
- Type:
- Lentiviral
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Promoter:
- EF-1α
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- EF1a-Fwd
- 3' Primer:
- pSIN-R: CAAACGCACACCGGCCTTATT
pSIN4-EF1a-LMO2-IRES-Puro vector Vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pSIN4-EF1a-LMO2-IRES-Puro vector Sequence
LOCUS V001083 8044 bp DNA circular SYN 13-MAY-2021 DEFINITION Exported. ACCESSION V001083 VERSION V001083 KEYWORDS pSIN4-EF1a-LMO2-IRES-Puro SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 8044) AUTHORS Elcheva I, Brok-Volchanskaya V, Kumar A, Liu P, Lee JH, Tong L, Vodyanik M, Swanson S, Stewart R, Kyba M, Yakubov E, Cooke J, Thomson JA, Slukvin I TITLE Direct induction of haematoendothelial programs in human pluripotent stem cells by transcriptional regulators. JOURNAL Nat Commun. 2014 Jul 14;5:4372. doi: 10.1038/ncomms5372. PUBMED 25019369 REFERENCE 2 (bases 1 to 8044) TITLE Direct Submission REFERENCE 3 (bases 1 to 8044) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Nat Commun."; date: "2014-07-14"; pages: " 10.1038/ncomms5372" SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..8044 /mol_type="other DNA" /organism="synthetic DNA construct" LTR 117..750 /label="3' LTR" /note="3' long terminal repeat (LTR) from HIV-1" misc_feature 797..922 /label="HIV-1 Psi" /note="packaging signal of human immunodeficiency virus type 1" misc_feature 1415..1648 /label="RRE" /note="The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm." CDS 1833..1877 /label="gp41 peptide" /note="antigenic peptide corresponding to amino acids 655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik et al., 2013)" CDS 2026..2067 /note="Protein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509" /label="Protein Tat" misc_feature 2164..2281 /label="cPPT/CTS" /note="central polypurine tract and central termination sequence of HIV-1" promoter 2410..3588 /label="EF-1-alpha promoter" /note="strong constitutive promoter for human elongation factor EF-1-alpha" regulatory 3599..3608 /label="Kozak sequence" /note="vertebrate consensus sequence for strong initiation of translation (Kozak, 1987)" /regulatory_class="other" CDS 3608..3631 /label="FLAG" /note="FLAG(R) epitope tag, followed by an enterokinase cleavage site" CDS 3632..4102 /gene="LMO2" /label="Rhombotin-2" /note="Rhombotin-2 from Homo sapiens. Accession#: P25791" misc_feature 4160..4746 /label="IRES2" /note="internal ribosome entry site (IRES) of the encephalomyocarditis virus (EMCV)" CDS 4766..5362 /label="PuroR" /note="puromycin N-acetyltransferase" LTR 5568..5801 /label="3' LTR (Delta-U3)" /note="self-inactivating 3' long terminal repeat (LTR) from HIV-1" polyA_signal 5958..6182 /label="bGH poly(A) signal" /note="bovine growth hormone polyadenylation signal" regulatory 6225..6234 /label="Kozak sequence" /note="vertebrate consensus sequence for strong initiation of translation (Kozak, 1987)" /regulatory_class="other" promoter 6278..6382 /label="AmpR promoter" CDS 6383..7240 /label="AmpR" /note="beta-lactamase" rep_origin 7414..8002 /direction=RIGHT /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication"