Cart 2

pMKV057 vector (V001118)

Price Information

Cat No. Plasmid Name Availability Add to cart
V001118 pMKV057 In stock, 1 week for quality controls

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pMKV057
Antibiotic Resistance:
Kanamycin
Length:
15986 bp
Type:
Plant Expression
Replication origin:
ori
Host:
Plants
Copy Number:
High Copy
Promoter:
CaMV35S(short)
Cloning Method:
Restriction Enzyme
5' Primer:
taccctccgcgagatcatcc
3' Primer:
aacgtcagaagccgactgc

pMKV057 vector Vector Map

pMKV05715986 bp70014002100280035004200490056006300700077008400910098001050011200119001260013300140001470015400Replication-associated protein ARB T-DNA repeatpVS1 StaApVS1 RepApVS1 oriVpGEX 3'bomL4440oriKanRLB T-DNA repeatluciferaseNOS promoterCaMV 35S promoter

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pMKV057 vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       V001118                15986 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V001118
VERSION     V001118
KEYWORDS    pMKV057
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 15986)
  AUTHORS   Maher MF, Nasti RA, Vollbrecht M, Starker CG, Clark MD, Voytas DF
  TITLE     Plant gene editing through de novo induction of meristems.
  JOURNAL   Nat Biotechnol. 2019 Dec 16. pii: 10.1038/s41587-019-0337-2. doi:
            10.1038/s41587-019-0337-2.
   PUBMED   31844292
REFERENCE   2  (bases 1 to 15986)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 15986)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Nat
            Biotechnol. 2019 Dec 16. pii: 10.1038/s41587-019-0337-2. doi:
            10.1038/s41587-019-0337-2."
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..15986
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     CDS             complement(419..1294)
                     /note="Replication-associated protein A from Bean yellow
                     dwarf virus. Accession#: O39521"
                     /label="Replication-associated protein A"
     misc_feature    1668..1692
                     /label="RB T-DNA repeat"
                     /note="right border repeat from nopaline C58 T-DNA"
     CDS             2993..3619
                     /label="pVS1 StaA"
                     /note="stability protein from the Pseudomonas plasmid pVS1
                     (Heeb et al., 2000)"
     CDS             4051..5121
                     /label="pVS1 RepA"
                     /note="replication protein from the Pseudomonas plasmid
                     pVS1 (Heeb et al., 2000)"
     rep_origin      5190..5384
                     /label="pVS1 oriV"
                     /note="origin of replication for the Pseudomonas plasmid
                     pVS1 (Heeb et al., 2000)"
     primer_bind     complement(5620..5642)
                     /label="pGEX 3'"
                     /note="pGEX vectors, reverse primer"
     misc_feature    5728..5868
                     /label="bom"
                     /note="basis of mobility region from pBR322"
     primer_bind     complement(5883..5900)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(6054..6642)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(6732..7523)
                     /label="KanR"
                     /note="aminoglycoside phosphotransferase"
     misc_feature    7948..7972
                     /label="LB T-DNA repeat"
                     /note="left border repeat from nopaline C58 T-DNA"
     CDS             9810..11459
                     /label="luciferase"
                     /note="firefly luciferase"
     promoter        11911..12094
                     /label="NOS promoter"
                     /note="nopaline synthase promoter"
     promoter        14350..14695
                     /label="CaMV 35S promoter"
                     /note="strong constitutive promoter from cauliflower mosaic
                     virus"