Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V001155 | pSUMO1 | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pSUMO1
- Antibiotic Resistance:
- Streptomycin
- Length:
- 7815 bp
- Type:
- Bacterial Expression
- Replication origin:
- CloDF13 ori
- Copy Number:
- Low Copy
- Promoter:
- rbs
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- GATGAGAAAGAGAATCTCAG
- 3' Primer:
- TGCTAGTTATTGCTCAGCGG
pSUMO1 vector Vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pSUMO1 vector Sequence
LOCUS V001155 7815 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V001155
VERSION V001155
KEYWORDS pSUMO1
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 7815)
AUTHORS Weber AR, Schuermann D, Schar P
TITLE Versatile Recombinant SUMOylation System for the Production of
SUMO-Modified Protein.
JOURNAL PLoS One. 2014 Jul 9;9(7):e102157. doi:
10.1371/journal.pone.0102157. eCollection 2014.
PUBMED 25007328
REFERENCE 2 (bases 1 to 7815)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 7815)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "PLoS One.";
date: "2014-07-9"; pages: "
10.1371/journal.pone.0102157. eCollection 2014"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..7815
/mol_type="other DNA"
/organism="synthetic DNA construct"
promoter 2..20
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
protein_bind 21..45
/label="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
RBS 60..82
/label="RBS"
/note="efficient ribosome binding site from bacteriophage
T7 gene 10 (Olins and Rangwala, 1989)"
CDS 101..118
/label="6xHis"
/note="6xHis affinity tag"
CDS 140..430
/gene="SUMO1"
/label="Small ubiquitin-related modifier 1"
/note="Small ubiquitin-related modifier 1 from Sus scrofa.
Accession#: A7WLH8"
promoter 579..597
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
protein_bind 598..622
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
CDS 665..1138
/gene="ube2i"
/label="SUMO-conjugating enzyme UBC9"
/note="SUMO-conjugating enzyme UBC9 from Xenopus
tropicalis. Accession#: Q28CQ4"
CDS 1154..1198
/label="S-Tag"
/note="affinity and epitope tag derived from pancreatic
ribonuclease A"
terminator 1250..1297
/label="T7 terminator"
/note="transcription terminator for bacteriophage T7 RNA
polymerase"
promoter 1382..1400
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
protein_bind 1401..1425
/label="lac operator"
/bound_moiety="lac repressor encoded by lacI"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
CDS 1495..3414
/gene="UBA2"
/label="SUMO-activating enzyme subunit 2"
/note="SUMO-activating enzyme subunit 2 from Homo sapiens.
Accession#: Q9UBT2"
CDS 3446..4483
/gene="SAE1"
/label="SUMO-activating enzyme subunit 1"
/note="SUMO-activating enzyme subunit 1 from Homo sapiens.
Accession#: Q9UBE0"
terminator 4514..4561
/label="T7 terminator"
/note="transcription terminator for bacteriophage T7 RNA
polymerase"
CDS complement(4735..5523)
/label="SmR"
/note="aminoglycoside adenylyltransferase (Murphy, 1985)"
promoter complement(5524..5615)
/label="AmpR promoter"
rep_origin complement(5663..6401)
/direction=LEFT
/label="CloDF13 ori"
/note="Plasmids containing the CloDF13 (CDF) origin of
replication can be propagated in E. coli cells that contain
additional plasmids with compatible origins."
protein_bind complement(6577..6598)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
CDS complement(6614..7693)
/label="lacI"
/note="lac repressor"
promoter complement(7694..7771)
/label="lacI promoter"