Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V001194 | Cre-IRES-PuroR | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- Cre-IRES-PuroR
- Antibiotic Resistance:
- Ampicillin
- Length:
- 9229 bp
- Type:
- Mammalian Expression, Lentiviral
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Copy Number:
- High Copy
- Promoter:
- EF-1α
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- GGTTCATTCTCAAGCCTCAGACAGTG
Cre-IRES-PuroR vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
Cre-IRES-PuroR vector Sequence
LOCUS V001194 9229 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V001194
VERSION V001194
KEYWORDS Cre-IRES-PuroR
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 9229)
AUTHORS Somers A, Jean JC, Sommer CA, Omari A, Ford CC, Mills JA, Ying L,
Sommer AG, Jean JM, Smith BW, Lafyatis R, Demierre MF, Weiss DJ,
French DL, Gadue P, Murphy GJ, Mostoslavsky G, Kotton DN
TITLE Generation of transgene-free lung disease-specific human induced
pluripotent stem cells using a single excisable lentiviral stem cell
cassette.
JOURNAL Stem Cells. 2010 Oct . 28(10):1728-40.
PUBMED 20715179
REFERENCE 2 (bases 1 to 9229)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 9229)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Stem Cells.
2010 Oct . 28(10):1728-40."
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..9229
/mol_type="other DNA"
/organism="synthetic DNA construct"
primer_bind 55..74
/label="EBV-rev"
/note="SV40 polyA terminator, reverse primer"
LTR 266..899
/label="3' LTR"
/note="3' long terminal repeat (LTR) from HIV-1"
misc_feature 946..1071
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1568..1801
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 1986..2030
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2179..2220
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 2323..2440
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 2488..3666
/label="EF-1-alpha promoter"
/note="strong constitutive promoter for human elongation
factor EF-1-alpha"
regulatory 3671..3680
/label="Kozak sequence"
/note="vertebrate consensus sequence for strong initiation
of translation (Kozak, 1987)"
/regulatory_class="other"
CDS 3707..4735
/label="Cre"
/note="site-specific recombinase"
misc_feature 4741..5319
/label="IRES2"
/note="internal ribosome entry site (IRES) of the
encephalomyocarditis virus (EMCV)"
CDS 5323..5919
/label="PuroR"
/note="puromycin N-acetyltransferase"
misc_feature 5936..6524
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
LTR 6672..6852
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
primer_bind complement(6899..6917)
/label="pBRforEco"
/note="pBR322 vectors, upsteam of EcoRI site, forward
primer"
promoter 6985..7089
/label="AmpR promoter"
CDS 7090..7947
/label="AmpR"
/note="beta-lactamase"
rep_origin 8121..8709
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
primer_bind 8863..8880
/label="L4440"
/note="L4440 vector, forward primer"
primer_bind 8972..8991
/label="SV40pro-F"
/note="SV40 promoter/origin, forward primer"
protein_bind 9120..9141
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
promoter 9156..9186
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind 9194..9210
/label="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."