pCDH-EF1-copGFP-T2A-Puro vector (V001322)

Price Information

Cat No. Plasmid Name Availability Add to cart
V001322 pCDH-EF1-copGFP-T2A-Puro In stock, instant shipping

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

It is a 3rd gen lenti-vector. The 3rd generation LV packaging plasmid includes gag, coding for the virion main structural proteins; pol, responsible for the retrovirus-specific enzymes; and RRE, a binding site for the Rev protein which facilitates export of the RNA from the nucleus. This plasmid does not include Rev. The third-generation packaging system offers maximal biosafety but is more cumbersome, as it involves the transfection of four different plasmids in the producer cells. If you wish to use the 3rd gen lentivector, you need to have a lentiviral vector with a chimeric 5' LTR in which the HIV promoter is replaced with CMV or RSV, thus making it TAT-independent. Examples of these vectors include pLKO.1, pLL3.7, pLB, pLenti6, pSico, pCL and pCS. Most Aebischer and Trono lab lentiviral vectors CANNOT be used with this system. A lentiviral vector carrying a chimeric 5' LTR can be packaged with either the 2nd or 3rd generation packaging system.

Vector Name:
pCDH-EF1-copGFP-T2A-Puro
Antibiotic Resistance:
Ampicillin
Length:
8549 bp
Type:
Mammalian Expression, Lentiviral
Replication origin:
ori
Selection Marker:
Puromycin
Copy Number:
High Copy
Promoter:
EF-1α
Cloning Method:
Restriction Enzyme
5' Primer:
GCACTTGATGTAATTCTCC
3' Primer:
CAACACCACGGAATTGTCAG

pCDH-EF1-copGFP-T2A-Puro vector Vector Map

pCDH-EF1-copGFP-T2A-Puro8549 bp4008001200160020002400280032003600400044004800520056006000640068007200760080008400RSV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSEF-1-alpha promoterCopGFPT2APuroRWPRE3' LTR (Delta-U3)SV40 poly(A) signalSV40 oriM13 revlac operatorlac promoterCAP binding siteL4440oriAmpRAmpR promoterpBRforEcopGEX 3'pRS-markerM13 fwd

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

References

  • Maughan EF, Hynds RE, Pennycuick A, Nigro E, Gowers KHC, Denais C, Gómez-López S, Lazarus KA, Orr JC, Pearce DR, Clarke SE, Lee DDH, Woodall MNJ, Masonou T, Case KM, Teixeira VH, Hartley BE, Hewitt RJ, Al Yaghchi C, Sandhu GS, Birchall MA, O'Callaghan C, Smith CM, De Coppi P, Butler CR, Janes SM. Cell-intrinsic differences between human airway epithelial cells from children and adults. iScience. 2022 Oct 20;25(11):105409.

pCDH-EF1-copGFP-T2A-Puro vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       V001322                 8549 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V001322
VERSION     V001322
KEYWORDS    pCDH-EF1-copGFP-T2A-Puro
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 8549)
  TITLE     lenti vector
  JOURNAL   Unpublished
REFERENCE   2  (bases 1 to 8549)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 8549)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName:
            "Unpublished"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..8549
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        6..233
                     /label="RSV promoter"
                     /note="Rous sarcoma virus enhancer/promoter"
     LTR             234..414
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    458..583
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1076..1309
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             1493..1537
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             1686..1727
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    1804..1921
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        2013..3191
                     /label="EF-1-alpha promoter"
                     /note="strong constitutive promoter for human elongation
                     factor EF-1-alpha"
     CDS             3228..3893
                     /label="CopGFP"
                     /note="green fluorescent protein 2 from Pontellina plumata,
                     also known as ppluGFP2 (Shagin et al., 2004)"
     CDS             3978..4031
                     /label="T2A"
                     /note="2A peptide from Thosea asigna virus capsid protein"
     CDS             4032..4628
                     /label="PuroR"
                     /note="puromycin N-acetyltransferase"
     misc_feature    4644..5232
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     LTR             5306..5539
                     /label="3' LTR (Delta-U3)"
                     /note="self-inactivating 3' long terminal repeat (LTR) from
                     HIV-1"
     polyA_signal    5611..5745
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     rep_origin      5751..5886
                     /label="SV40 ori"
                     /note="SV40 origin of replication"
     primer_bind     complement(5924..5940)
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     protein_bind    complement(5948..5964)
                     /label="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(5972..6002)
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(6017..6038)
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     primer_bind     complement(6155..6172)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(6326..6914)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(7088..7945)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(7946..8050)
                     /label="AmpR promoter"
     primer_bind     8118..8136
                     /label="pBRforEco"
                     /note="pBR322 vectors, upsteam of EcoRI site, forward
                     primer"
     primer_bind     complement(8174..8196)
                     /label="pGEX 3'"
                     /note="pGEX vectors, reverse primer"
     primer_bind     8296..8315
                     /label="pRS-marker"
                     /note="pRS vectors, use to sequence yeast selectable
                     marker"
     primer_bind     8524..8540
                     /label="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
                     variants"