Basic Vector Information
- Vector Name:
- Flag-HA-CYLD
- Antibiotic Resistance:
- Ampicillin
- Length:
- 9307 bp
- Type:
- Mammalian Expression, Retroviral
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Copy Number:
- High Copy
- Promoter:
- MSCV
- Cloning Method:
- Gateway Cloning
- 5' Primer:
- CAGCCCTCACTCCTTCTCTAGG
- 3' Primer:
- CAAGCGGCTTCGGCCAGTAAC
Flag-HA-CYLD vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
Flag-HA-CYLD vector Sequence
LOCUS V001372 9307 bp DNA circular SYN 13-MAY-2021 DEFINITION Exported. ACCESSION V001372 VERSION V001372 KEYWORDS Flag-HA-CYLD. SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 9307) AUTHORS Sowa ME, Bennett EJ, Gygi SP, Harper JW TITLE Defining the human deubiquitinating enzyme interaction landscape. JOURNAL Cell. 2009 Jul 23. 138(2):389-403. PUBMED 19615732 REFERENCE 2 (bases 1 to 9307) TITLE Direct Submission REFERENCE 3 (bases 1 to 9307) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Cell. 2009 Jul 23. 138(2):389-403." SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..9307 /mol_type="other DNA" /organism="synthetic DNA construct" protein_bind 107..128 /label="CAP binding site" /note="CAP binding activates transcription in the presence of cAMP." promoter 143..173 /label="lac promoter" /note="promoter for the E. coli lac operon" protein_bind 181..197 /label="lac operator" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." LTR complement(359..873) /label="3' LTR" /note="3' long terminal repeat from murine embryonic stem cell virus" CDS complement(952..1548) /label="PuroR" /note="puromycin N-acetyltransferase" misc_feature complement(1549..2125) /label="IRES2" /note="internal ribosome entry site (IRES) of the encephalomyocarditis virus (EMCV)" protein_bind 2142..2166 /label="attB2" /note="recombination site for the Gateway(R) BP reaction" CDS complement(2179..5037) /gene="CYLD" /label="Ubiquitin carboxyl-terminal hydrolase CYLD" /note="Ubiquitin carboxyl-terminal hydrolase CYLD from Bos taurus. Accession#: Q1RMU2" protein_bind complement(5046..5070) /gene="mutant version of attB" /label="attB1" /bound_moiety="BP Clonase(TM)" /note="recombination site for the Gateway(R) BP reaction" CDS complement(5086..5112) /label="HA" /note="HA (human influenza hemagglutinin) epitope tag" CDS complement(5125..5148) /label="FLAG" /note="FLAG(R) epitope tag, followed by an enterokinase cleavage site" regulatory 5148..5157 /label="Kozak sequence" /note="vertebrate consensus sequence for strong initiation of translation (Kozak, 1987)" /regulatory_class="other" CDS complement(5170..5586) /label="gag (truncated)" /note="truncated Moloney murine leukemia virus (MMLV) gag gene lacking the start codon" misc_feature complement(5653..5994) /label="MESV Psi" /note="packaging signal of murine embryonic stem cell virus" LTR complement(6058..6574) /label="5' LTR" /note="5' long terminal repeat from murine embryonic stem cell virus" primer_bind complement(6774..6793) /label="pBRrevBam" /note="pBR322 vectors, tet region, downstream of BamHI, reverse primer" primer_bind complement(6921..6943) /label="M13/pUC Forward" /note="In lacZ gene" primer_bind complement(7137..7156) /label="pRS-marker" /note="pRS vectors, use to sequence yeast selectable marker" primer_bind 7256..7278 /label="pGEX 3'" /note="pGEX vectors, reverse primer" primer_bind complement(7316..7334) /label="pBRforEco" /note="pBR322 vectors, upsteam of EcoRI site, forward primer" promoter 7402..7506 /label="AmpR promoter" CDS 7507..8364 /label="AmpR" /note="beta-lactamase" rep_origin 8538..9126 /direction=RIGHT /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" primer_bind 9280..9297 /label="L4440" /note="L4440 vector, forward primer"
This page is informational only.