pDule-pCNF vector (V001401)

Price Information

Cat No.	Plasmid Name	Availability	Add to cart
V001401	pDule-pCNF	In stock, 1 week for quality controls	Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:: pDule-pCNF

Antibiotic Resistance:: Tetracycline

Length:: 6333 bp

Type:: Bacterial Expression

Replication origin:: p15A ori

Copy Number:: Low Copy

Promoter:: tet

Cloning Method:: Restriction Enzyme

5' Primer:: CGTCACTGCGTCTTTTACTG

pDule-pCNF vector Vector Map

View Map in NovoBuilder

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pDule-pCNF vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       V001401                 6333 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V001401
VERSION     V001401
KEYWORDS    pDule-pCNF
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 6333)
  AUTHORS   Miyake-Stoner SJ, Miller AM, Hammill JT, Peeler JC, Hess KR, Mehl
            RA, Brewer SH
  TITLE     Probing protein folding using site-specifically encoded unnatural
            amino acids as FRET donors with tryptophan.
  JOURNAL   Biochemistry. 2009 Jun 30;48(25):5953-62. doi: 10.1021/bi900426d.
   PUBMED   19492814
REFERENCE   2  (bases 1 to 6333)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 6333)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi: "10"; journalName:
            "Biochemistry"; date: "2009-06-30- 30"; volume: "48"; issue: "25";
            pages: "5953-62"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..6333
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     CDS             194..1111
                     /gene="tyrS"
                     /label="Tyrosine--tRNA ligase"
                     /note="Tyrosine--tRNA ligase from Methanocaldococcus
                     jannaschii (strain ATCC 43067 / DSM 2661 / JAL-1 / JCM
                     10045 / NBRC 100440). Accession#: Q57834"
     CDS             1161..1190
                     /label="Myc"
                     /note="Myc (human c-Myc proto-oncogene) epitope tag"
     CDS             1206..1223
                     /label="6xHis"
                     /note="6xHis affinity tag"
     primer_bind     complement(1279..1296)
                     /label="pBAD Reverse"
                     /note="For vectors with E. coli araBAD promoter, reverse
                     primer"
     terminator      1449..1535
                     /label="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
                     gene"
     primer_bind     complement(1742..1759)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(1876..2421)
                     /direction=LEFT
                     /label="p15A ori"
                     /note="Plasmids containing the medium-copy-number p15A
                     origin of replication can be propagated in E. coli cells
                     that contain a second plasmid with the ColE1 origin."
     promoter        2533..2561
                     /label="tet promoter"
                     /note="E. coli promoter for tetracycline efflux protein
                     gene"
     CDS             2609..3796
                     /label="TcR"
                     /note="tetracycline efflux protein"
     primer_bind     4121..4137
                     /label="M13 fwd"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     primer_bind     5121..5143
                     /label="pGEX 3'"
                     /note="pGEX vectors, reverse primer"
     CDS             complement(5302..6177)
                     /label="araC"
                     /note="L-arabinose regulatory protein"