pJMP3 vector (V001432)

Price Information

Cat No. Plasmid Name Availability Buy one, get one free! (?)
V001432 pJMP3 In stock, 1 week for quality controls

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pJMP3
Antibiotic Resistance:
Ampicillin
Length:
7263 bp
Type:
Bacterial Expression, CRISPR
Replication origin:
ori
Selection Marker:
Bacillus subtilis spectinomycin marker
Copy Number:
High Copy
Promoter:
veg
Cloning Method:
Restriction Enzyme
5' Primer:
tgtccgttccatctgtgaga

pJMP3 vector Map

pJMP37263 bp300600900120015001800210024002700300033003600390042004500480051005400570060006300660069007200gRNA scaffoldMyc6xHispBAD ReverserrnB T1 terminatorermCoriAmpRAmpR promoterpBRforEco

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pJMP3 vector Sequence

LOCUS       V001432                 7263 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V001432
VERSION     V001432
KEYWORDS    pJMP3
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 7263)
  AUTHORS   Peters JM, Colavin A, Shi H, Czarny TL, Larson MH, Wong S, Hawkins
            JS, Lu CH, Koo BM, Marta E, Shiver AL, Whitehead EH, Weissman JS,
            Brown ED, Qi LS, Huang KC, Gross CA
  TITLE     A Comprehensive, CRISPR-based Functional Analysis of Essential Genes
            in Bacteria.
  JOURNAL   Cell. 2016 Jun 2;165(6):1493-506. doi: 10.1016/j.cell.2016.05.003.
            Epub 2016 May 26.
   PUBMED   27238023
REFERENCE   2  (bases 1 to 7263)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 7263)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi:
            "10.1016/j.cell.2016.05.003"; journalName: "Cell"; date: "2016-06-2-
            2"; volume: "165"; issue: "6"; pages: "1493-506"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..7263
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     misc_RNA        858..933
                     /label="gRNA scaffold"
                     /note="guide RNA scaffold for the Streptococcus pyogenes
                     CRISPR/Cas9 system"
     CDS             954..983
                     /label="Myc"
                     /note="Myc (human c-Myc proto-oncogene) epitope tag"
     CDS             999..1016
                     /label="6xHis"
                     /note="6xHis affinity tag"
     primer_bind     complement(1072..1089)
                     /label="pBAD Reverse"
                     /note="For vectors with E. coli araBAD promoter, reverse
                     primer"
     terminator      1242..1288
                     /label="rrnB T1 terminator"
                     /note="transcription terminator T1 from the E. coli rrnB
                     gene"
     CDS             3892..4623
                     /gene="ermC"
                     /label="rRNA adenine N-6-methyltransferase"
                     /note="rRNA adenine N-6-methyltransferase from
                     Staphylococcus aureus. Accession#: P02979"
     rep_origin      complement(5434..6022)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(6196..7053)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(7054..7158)
                     /label="AmpR promoter"
     primer_bind     7226..7244
                     /label="pBRforEco"
                     /note="pBR322 vectors, upsteam of EcoRI site, forward
                     primer"