Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V001694 | pRPR1_gRNA_handle_RPR1t | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pRPR1_gRNA_handle_RPR1t
- Antibiotic Resistance:
- Ampicillin
- Length:
- 7664 bp
- Type:
- Yeast Expression, CRISPR, Synthetic Biology
- Replication origin:
- ori
- Host:
- Yeast
- Selection Marker:
- LEU2
- Copy Number:
- High Copy
- Promoter:
- LEU2
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- GCGGATAACAATTTCACACAGG
pRPR1_gRNA_handle_RPR1t vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pRPR1_gRNA_handle_RPR1t vector Sequence
LOCUS V001694 7664 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V001694
VERSION V001694
KEYWORDS pRPR1_gRNA_handle_RPR1t
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 7664)
AUTHORS Farzadfard F, Perli SD, Lu TK
TITLE Tunable and Multifunctional Eukaryotic Transcription Factors Based
on CRISPR/Cas.
JOURNAL ACS Synth Biol. 2013 Sep 11.
PUBMED 23977949
REFERENCE 2 (bases 1 to 7664)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 7664)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "ACS Synth
Biol. 2013 Sep 11."
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..7664
/mol_type="other DNA"
/organism="synthetic DNA construct"
primer_bind 77..94
/label="L4440"
/note="L4440 vector, forward primer"
promoter 324..342
/label="T3 promoter"
/note="promoter for bacteriophage T3 RNA polymerase"
promoter 365..771
/label="RPR1 promoter"
/note="promoter for the S. cerevisiae RNase P RNA gene"
misc_RNA 779..854
/label="gRNA scaffold"
/note="guide RNA scaffold for the Streptococcus pyogenes
CRISPR/Cas9 system"
terminator 867..929
/label="RPR1 terminator"
/note="transcription terminator for the S. cerevisiae RNase
P RNA gene"
CDS complement(1062..1313)
/gene="TIM9"
/label="Mitochondrial import inner membrane translocase
subunit TIM9"
/note="Mitochondrial import inner membrane translocase
subunit TIM9 from Saccharomyces cerevisiae (strain ATCC
204508 / S288c). Accession#: O74700"
promoter complement(1319..1337)
/label="T7 promoter"
/note="promoter for bacteriophage T7 RNA polymerase"
primer_bind complement(1347..1363)
/label="M13 fwd"
/note="common sequencing primer, one of multiple similar
variants"
rep_origin 1504..1959
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 2260..2667
/label="LEU2 promoter"
CDS 2668..3759
/label="LEU2"
/note="3-isopropylmalate dehydrogenase, required for
leucine biosynthesis"
primer_bind complement(4256..4275)
/label="pRS-marker"
/note="pRS vectors, use to sequence yeast selectable
marker"
primer_bind 4375..4397
/label="pGEX 3'"
/note="pGEX vectors, reverse primer"
primer_bind complement(4435..4453)
/label="pBRforEco"
/note="pBR322 vectors, upsteam of EcoRI site, forward
primer"
rep_origin 4494..5836
/label="2u ori"
/note="yeast 2u plasmid origin of replication"
promoter 5863..5967
/label="AmpR promoter"
CDS 5968..6825
/label="AmpR"
/note="beta-lactamase"
rep_origin 6999..7587
/direction=RIGHT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"