Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V001805 | pShuttle-CMV-lacZ | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pShuttle-CMV-lacZ
- Antibiotic Resistance:
- Kanamycin
- Length:
- 10660 bp
- Type:
- Adenoviral vectors
- Replication origin:
- ori
- Copy Number:
- Low copy number
- Promoter:
- CMV
- Cloning Method:
- Enzyme digestion and ligation
- 5' Primer:
- pShuttle-CMV-F: GGTCTATATAAGCAGAGCTG
- 3' Primer:
- pShuttle-CMV-R: GTGGTATGGCTGATTATGATCAG
pShuttle-CMV-lacZ vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pShuttle-CMV-lacZ vector Sequence
LOCUS V001805 10660 bp DNA circular SYN 13-JAN-2022
DEFINITION Exported.
ACCESSION V001805
VERSION V001805
KEYWORDS .
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 10660)
TITLE Direct Submission
REFERENCE 2 (bases 1 to 10660)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..10660
/mol_type="other DNA"
/organism="synthetic DNA construct"
repeat_region 1..103
/label="ITR"
/note="inverted terminal repeat of human adenovirus
serotype 5"
misc_signal 191..340
/label="Ad5 Psi"
/note="packaging signal for adenovirus serotype 5"
enhancer 398..701
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 702..905
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
CDS 970..4014
/label="lacZ"
/note="beta-galactosidase"
polyA_signal 4323..4444
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
CDS 4527..4946
/gene="IX"
/label="Hexon-interlacing protein"
/note="Hexon-interlacing protein from Human adenovirus C
serotype 5. Accession#: P03281"
CDS complement(5012..6346)
/gene="IVa2"
/label="Packaging protein 1"
/note="Packaging protein 1 from Human adenovirus C serotype
5. Accession#: P03271"
repeat_region 7620..7722
/label="ITR"
/note="inverted terminal repeat of human adenovirus
serotype 5"
rep_origin complement(7982..8570)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS 9402..10193
/label="NeoR/KanR"
/note="aminoglycoside phosphotransferase"
rep_origin complement(10244..10623)
/direction=LEFT
/label="M13 ori"
/note="M13 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"