Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V010582 | pCDH-EF1-FHC | In stock, instant shipping |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pCDH-EF1-FHC
- Antibiotic Resistance:
- Ampicillin
- Length:
- 7714 bp
- Type:
- Mammalian Expression, Lentiviral
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Promoter:
- RSV
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- EF1a-F_alt (gccgtgaacgttctttttc)
- 3' Primer:
- IRES-R (CCTCACATTGCCAAAAGACG)
pCDH-EF1-FHC vector Vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pCDH-EF1-FHC vector Sequence
LOCUS V010582 7714 bp DNA circular SYN 13-MAY-2021 DEFINITION Exported. ACCESSION V010582 VERSION V010582 KEYWORDS pCDH-EF1-FHC SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 7714) AUTHORS Yousefzadeh MJ, Wyatt DW, Takata K, Mu Y, Hensley SC, Tomida J, Bylund GO, Doublie S, Johansson E, Ramsden DA, McBride KM, Wood RD TITLE Mechanism of suppression of chromosomal instability by DNA polymerase POLQ. JOURNAL PLoS Genet. 2014 Oct 2;10(10):e1004654. doi: 10.1371/journal.pgen.1004654. eCollection 2014 Oct. PUBMED 25275444 REFERENCE 2 (bases 1 to 7714) TITLE Direct Submission REFERENCE 3 (bases 1 to 7714) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "PLoS Genet."; date: "2014-10-2"; pages: " 10.1371/journal.pgen.1004654. eCollection 2014 Oct" SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..7714 /mol_type="other DNA" /organism="synthetic DNA construct" CDS 144..188 /label="gp41 peptide" /note="antigenic peptide corresponding to amino acids 655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik et al., 2013)" CDS 337..378 /note="Protein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509" /label="Protein Tat" misc_feature 455..571 /label="cPPT/CTS" /note="central polypurine tract and central termination sequence of HIV-1" promoter 614..825 /label="EF-1-alpha core promoter" /note="core promoter for human elongation factor EF-1-alpha" LTR 838..1106 /label="5' LTR (truncated)" /note="truncated 5' long terminal repeat (LTR) from human T-cell leukemia virus (HTLV) type 1" CDS 1178..1201 /label="FLAG" /note="FLAG(R) epitope tag, followed by an enterokinase cleavage site" CDS 1217..1243 /label="HA" /note="HA (human influenza hemagglutinin) epitope tag" misc_feature 1254..1826 /label="IRES" /note="internal ribosome entry site (IRES) of the encephalomyocarditis virus (EMCV)" CDS 1835..2431 /label="PuroR" /note="puromycin N-acetyltransferase" misc_feature 2441..3029 /label="WPRE" /note="woodchuck hepatitis virus posttranscriptional regulatory element" LTR 3103..3336 /label="3' LTR (Delta-U3)" /note="self-inactivating 3' long terminal repeat (LTR) from HIV-1" polyA_signal 3408..3542 /label="SV40 poly(A) signal" /note="SV40 polyadenylation signal" rep_origin 3569..3704 /label="SV40 ori" /note="SV40 origin of replication" primer_bind complement(3737..3753) /label="M13 rev" /note="common sequencing primer, one of multiple similar variants" protein_bind complement(3761..3777) /label="lac operator" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." promoter complement(3785..3815) /label="lac promoter" /note="promoter for the E. coli lac operon" protein_bind complement(3830..3851) /label="CAP binding site" /note="CAP binding activates transcription in the presence of cAMP." primer_bind complement(3968..3985) /label="L4440" /note="L4440 vector, forward primer" rep_origin complement(4139..4727) /direction=LEFT /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" CDS complement(4901..5758) /label="AmpR" /note="beta-lactamase" promoter complement(5759..5863) /label="AmpR promoter" primer_bind 5931..5949 /label="pBRforEco" /note="pBR322 vectors, upsteam of EcoRI site, forward primer" primer_bind complement(5987..6009) /label="pGEX 3'" /note="pGEX vectors, reverse primer" primer_bind 6109..6128 /label="pRS-marker" /note="pRS vectors, use to sequence yeast selectable marker" primer_bind 6337..6353 /label="M13 fwd" /note="common sequencing primer, one of multiple similar variants" promoter 6368..6594 /label="RSV promoter" /note="Rous sarcoma virus enhancer/promoter" LTR 6595..6775 /label="5' LTR (truncated)" /note="truncated 5' long terminal repeat (LTR) from HIV-1" misc_feature 6822..6947 /label="HIV-1 Psi" /note="packaging signal of human immunodeficiency virus type 1" misc_feature 7440..7673 /label="RRE" /note="The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm."