Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V000178 | pLV-hTERT-IRES-hygro | In stock, instant shipping |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pLV-hTERT-IRES-hygro
- Antibiotic Resistance:
- Ampicillin
- Length:
- 12531 bp
- Type:
- Lentiviral
- Replication origin:
- ori
- Selection Marker:
- Hygromycin
- Copy Number:
- High Copy
- Promoter:
- EF-1α
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- TCAAGCCTCAGACAGTGGTTC
- 3' Primer:
- ACACCGGCCTTATTCCAA
- Growth Strain(s):
- stbl3
- Growth Temperature:
- 37℃
pLV-hTERT-IRES-hygro vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pLV-hTERT-IRES-hygro vector Sequence
LOCUS V000178 12531 bp DNA circular SYN 17-JUN-2021 DEFINITION Exported. ACCESSION V000178 VERSION V000178 KEYWORDS pLV-hTERT-IRES-hygro SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 12531) AUTHORS Hayer A, Shao L, Chung M, Joubert LM, Yang HW, Tsai FC, Bisaria A, Betzig E, Meyer T TITLE Engulfed cadherin fingers are polarized junctional structures between collectively migrating endothelial cells. JOURNAL Nat Cell Biol. 2016 Dec;18(12):1311-1323. doi: 10.1038/ncb3438. Epub 2016 Nov 14. PUBMED 27842057 REFERENCE 2 (bases 1 to 12531) TITLE Direct Submission REFERENCE 3 (bases 1 to 12531) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; doi: "10.1038/ncb3438"; journalName: "Nat Cell Biol"; date: "2016-12"; volume: "18"; issue: "12"; pages: "1311-1323" SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..12531 /mol_type="other DNA" /organism="synthetic DNA construct" LTR 1..634 /label="3' LTR" /note="3' long terminal repeat (LTR) from HIV-1" misc_feature 681..806 /label="HIV-1 Psi" /note="packaging signal of human immunodeficiency virus type 1" misc_feature 1303..1536 /label="RRE" /note="The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm." CDS 1721..1765 /label="gp41 peptide" /note="antigenic peptide corresponding to amino acids 655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik et al., 2013)" CDS 1914..1955 /note="Protein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509" /label="Protein Tat" misc_feature 2027..2144 /label="cPPT/CTS" /note="central polypurine tract and central termination sequence of HIV-1" promoter 2207..3380 /label="EF-1-alpha promoter" /note="strong constitutive promoter for human elongation factor EF-1-alpha" CDS 3387..6782 /label="hTERT" /note="human telomerase reverse transcriptase, the catalytic subunit of telomerase" misc_feature 6886..7448 /label="IRES" /note="internal ribosome entry site (IRES) of the encephalomyocarditis virus (EMCV)" CDS 7451..8473 /label="HygR" /note="aminoglycoside phosphotransferase from E. coli" misc_feature 8500..9088 /label="WPRE" /note="woodchuck hepatitis virus posttranscriptional regulatory element" LTR 9295..9928 /label="5' LTR" /note="5' long terminal repeat (LTR) from HIV-1" primer_bind complement(10056..10072) /label="M13 rev" /note="common sequencing primer, one of multiple similar variants" primer_bind complement(10056..10072) /label="M13 Reverse" /note="In lacZ gene. Also called M13-rev" primer_bind complement(10069..10091) /label="M13/pUC Reverse" /note="In lacZ gene" protein_bind 10080..10096 /label="lac operator" /bound_moiety="lac repressor encoded by lacI" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." promoter complement(10104..10134) /label="lac promoter" /note="promoter for the E. coli lac operon" protein_bind complement(10149..10170) /label="CAP binding site" /note="CAP binding activates transcription in the presence of cAMP." primer_bind complement(10287..10304) /label="L4440" /note="L4440 vector, forward primer" rep_origin complement(10458..11046) /direction=LEFT /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" CDS complement(11220..12077) /label="AmpR" /note="beta-lactamase" promoter complement(12078..12182) /label="AmpR promoter" polyA_signal 12230..12364 /label="SV40 poly(A) signal" /note="SV40 polyadenylation signal"