Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V012407 | FUGW | In stock (lyophilized plasmid) |
Buy one, get one free! |
Two vials of lyophilized plasmid will be delivered, each vial is about 5µg.
Basic Vector Information
Plasmid pFUGW was constructed by inserting the following into the multicloning site of HR'CS-G: HIV-1 flap sequence PCR-amplified from the HIV NLA4.3 genome, the human polyubiquitin promoter-C (gift of L. Thiel, Amgen), the EGFP gene, and the WRE (woodchuck hepatitis virus posttranscriptional regulatory element) (gift of D. Trono, University of Geneva). Lentiviruses can be produced by cotransfecting the HIV-1 packaging vector Delta8.9 and the VSVG envelope glycoprotein into 293 fibroblasts.Order of elements: CMV LTR PstI flap PacI Ubiquitin promoter SpeI HindIII PstI SalI XbaI BamHI SmaI KpnI GFP NotI EagI XbaI EcoRI EcoRV HindIII ClaI WRE ClaI SalI XhoI KpnI 3'LTR ApaI PmeI.Please note that there are 2 gaps upstream of the EGFP between author's provided sequence and Addgene's quality control sequence. These gaps are in the non-coding vector region and should not affect the expression of EGFP.
- Vector Name:
- FUGW
- Antibiotic Resistance:
- Ampicillin
- Length:
- 9955 bp
- Type:
- Lentiviral vectors
- Replication origin:
- ori
- Copy Number:
- High copy number
- Promoter:
- UbC
- Cloning Method:
- Enzyme digestion and ligation
- 5' Primer:
- hUBCpro-F: TGAAGCTCCGGTTTTGAACT
- 3' Primer:
- EGFP-N: CGTCGCCGTCCAGCTCGACCAG
- Fusion Tag:
- C-EGFP
- Growth Strain(s):
- Stbl3
- Growth Temperature:
- 37℃
FUGW vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
References
- Dong H, Du L, Cai S, Lin W, Chen C, Still M, Yao Z, Coppes RP, Pan Y, Zhang D, Gao S, Zhang H. Tyrosine Phosphatase PTPRO Deficiency in ERBB2-Positive Breast Cancer Contributes to Poor Prognosis and Lapatinib Resistance. Front Pharmacol. 2022 Apr 1;13:838171.
FUGW vector Sequence
LOCUS fugw. 9955 bp DNA circular SYN 05-AUG-2018 DEFINITION 3rd gen lentiviral plasmid with hUbC-driven EGFP; can be used for cDNA expresion. ACCESSION . VERSION . KEYWORDS fugw. SOURCE synthetic DNA construct ORGANISM synthetic DNA construct REFERENCE 1 (bases 1 to 9955) AUTHORS Lois C, Hong EJ, Pease S, Brown EJ, Baltimore D TITLE Germline transmission and tissue-specific expression of transgenes delivered by lentiviral vectors. JOURNAL Science. 2002 Feb 1. 295(5556):868-72. PUBMED 11786607 REFERENCE 2 (bases 1 to 9955) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Science. 2002 Feb 1. 295(5556):868-72." FEATURES Location/Qualifiers source 1..9955 /mol_type="other DNA" /organism="synthetic DNA construct" enhancer 238..617 /label=CMV enhancer /note="human cytomegalovirus immediate early enhancer" promoter 618..820 /label=CMV promoter /note="human cytomegalovirus (CMV) immediate early promoter" LTR 835..1015 /label=5' LTR (truncated) /note="5' LTR (truncated)" /note="truncated 5' long terminal repeat (LTR) from HIV-1" misc_feature 1062..1187 /label=HIV-1 Psi /note="packaging signal of human immunodeficiency virus type 1" misc_feature 1680..1913 /label=RRE /note="The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm." CDS 2098..2142 /label=gp41 peptide /note="antigenic peptide corresponding to amino acids 655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik et al., 2013)" CDS 2291..2332 /note="Protein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509" misc_feature 2440..2557 /label=cPPT/CTS /note="central polypurine tract and central termination sequence of HIV-1" promoter 2622..3833 /label=UbC promoter /note="human ubiquitin C promoter" CDS 3887..4603 /label=EGFP /note="enhanced GFP" misc_feature 4647..5235 /label=WPRE /note="woodchuck hepatitis virus posttranscriptional regulatory element" primer_bind complement(5238..5254) /label=KS primer /note="KS primer" /note="common sequencing primer, one of multiple similar variants" LTR 5760..5940 /label=5' LTR (truncated) /note="truncated 5' long terminal repeat (LTR) from HIV-1" polyA_signal 5972..6196 /label=bGH poly(A) signal /note="bovine growth hormone polyadenylation signal" rep_origin 6242..6670 /label=f1 ori /note="f1 bacteriophage origin of replication; arrow indicates direction of (+) strand synthesis" promoter 6684..7013 /label=SV40 promoter /note="SV40 enhancer and early promoter" promoter 7061..7108 /label=EM7 promoter /note="synthetic bacterial promoter" CDS 7127..7498 /label=BleoR /note="antibiotic-binding protein" polyA_signal 7631..7764 /label=SV40 poly(A) signal /note="SV40 polyadenylation signal" primer_bind complement(7801..7817) /label=M13 rev /note="M13 rev" /note="common sequencing primer, one of multiple similar variants" protein_bind 7825..7841 /label=lac repressor encoded by lacI binding site /bound_moiety="lac repressor encoded by lacI" /note="lac operator" /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." promoter complement(7849..7879) /label=lac promoter /note="promoter for the E. coli lac operon" protein_bind complement(7894..7915) /label=CAP binding site /note="CAP binding activates transcription in the presence of cAMP." rep_origin complement(8203..8791) /direction=LEFT /label=ori /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" CDS complement(8965..9822) /label=AmpR /note="beta-lactamase" promoter complement(9823..9927) /label=AmpR promoter