FUGW vector (Cat. No.: V012407)
Note: FUGW is a lentiviral transfer plasmid featuring the ubiquitin C (Ubc) promoter driving expression of GFP. It includes a WPRE element to boost transgene expression and a PGK-puromycin resistance cassette. Widely used for neuronal tracing and stable gene expression in mammalian cells.
Please note: there are 2 gaps upstream of the EGFP between author's provided sequence and Addgene's quality control sequence. These gaps are in the non-coding vector region and should not affect the expression of EGFP.
- Name:
- FUGW
- Antibiotic Resistance:
- Ampicillin
- Length:
- 9955 bp
- Type:
- Lentiviral vectors
- Replication origin:
- ori
- Copy Number:
- High copy number
- Promoter:
- UbC
- Cloning Method:
- Enzyme digestion and ligation
- 5' Primer:
- hUBCpro-F: TGAAGCTCCGGTTTTGAACT
- 3' Primer:
- EGFP-N: CGTCGCCGTCCAGCTCGACCAG
- Fusion Tag:
- C-EGFP
- Growth Strain(s):
- Stbl3
- Growth Temperature:
- 37℃
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
References
- Dong H, Du L, Cai S, Lin W, Chen C, Still M, Yao Z, Coppes RP, Pan Y, Zhang D, Gao S, Zhang H. Tyrosine Phosphatase PTPRO Deficiency in ERBB2-Positive Breast Cancer Contributes to Poor Prognosis and Lapatinib Resistance. Front Pharmacol. 2022 Apr 1;13:838171.
FUGW vector (Cat. No.: V012407) Sequence
LOCUS V012407 9955 bp DNA circular SYN 05-AUG-2018
DEFINITION Exported.
ACCESSION V012407
VERSION V012407
KEYWORDS fugw
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 9955)
AUTHORS Lois C, Hong EJ, Pease S, Brown EJ, Baltimore D
TITLE Germline transmission and tissue-specific expression of transgenes
delivered by lentiviral vectors.
JOURNAL Science. 2002 Feb 1. 295(5556):868-72.
PUBMED 11786607
REFERENCE 2 (bases 1 to 9955)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; journalName: "Science.
2002 Feb 1. 295(5556):868-72."
FEATURES Location/Qualifiers
source 1..9955
/mol_type="other DNA"
/organism="synthetic DNA construct"
enhancer 238..617
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 618..820
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
LTR 835..1015
/label="5' LTR (truncated)"
/note="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
misc_feature 1062..1187
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 1680..1913
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 2098..2142
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 2291..2332
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"
misc_feature 2440..2557
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
promoter 2622..3833
/label="UbC promoter"
/note="human ubiquitin C promoter"
CDS 3887..4603
/label="EGFP"
/note="enhanced GFP"
misc_feature 4647..5235
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
primer_bind complement(5238..5254)
/label="KS primer"
/note="KS primer"
/note="common sequencing primer, one of multiple similar
variants"
LTR 5760..5940
/label="5' LTR (truncated)"
/note="truncated 5' long terminal repeat (LTR) from HIV-1"
polyA_signal 5972..6196
/label="bGH poly(A) signal"
/note="bovine growth hormone polyadenylation signal"
rep_origin 6242..6670
/label="f1 ori"
/note="f1 bacteriophage origin of replication; arrow
indicates direction of (+) strand synthesis"
promoter 6684..7013
/label="SV40 promoter"
/note="SV40 enhancer and early promoter"
promoter 7061..7108
/label="EM7 promoter"
/note="synthetic bacterial promoter"
CDS 7127..7498
/label="BleoR"
/note="antibiotic-binding protein"
polyA_signal 7631..7764
/label="SV40 poly(A) signal"
/note="SV40 polyadenylation signal"
primer_bind complement(7801..7817)
/label="M13 rev"
/note="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
protein_bind 7825..7841
/label="lac repressor encoded by lacI binding site"
/bound_moiety="lac repressor encoded by lacI"
/note="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
promoter complement(7849..7879)
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind complement(7894..7915)
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
rep_origin complement(8203..8791)
/direction=LEFT
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(8965..9822)
/label="AmpR"
/note="beta-lactamase"
promoter complement(9823..9927)
/label="AmpR promoter"