FUGW vector (Cat. No.: V012407)

FUGW9955 bp4008001200160020002400280032003600400044004800520056006000640068007200760080008400880092009600CMV enhancerCMV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSUbC promoterEGFPWPREKS primer5' LTR (truncated)bGH poly(A) signalf1 oriSV40 promoterEM7 promoterBleoRSV40 poly(A) signalM13 revlac operatorlac promoterCAP binding siteoriAmpRAmpR promoter
Basic Information

Note: FUGW is a lentiviral transfer plasmid featuring the ubiquitin C (Ubc) promoter driving expression of GFP. It includes a WPRE element to boost transgene expression and a PGK-puromycin resistance cassette. Widely used for neuronal tracing and stable gene expression in mammalian cells.

Please note: there are 2 gaps upstream of the EGFP between author's provided sequence and Addgene's quality control sequence. These gaps are in the non-coding vector region and should not affect the expression of EGFP.

Name:
FUGW
Antibiotic Resistance:
Ampicillin
Length:
9955 bp
Type:
Lentiviral vectors
Replication origin:
ori
Copy Number:
High copy number
Promoter:
UbC
Cloning Method:
Enzyme digestion and ligation
5' Primer:
hUBCpro-F:   TGAAGCTCCGGTTTTGAACT
3' Primer:
EGFP-N: CGTCGCCGTCCAGCTCGACCAG
Fusion Tag:
C-EGFP
Growth Strain(s):
Stbl3
Growth Temperature:
37℃
$ 198.7
In stock, instant shipping
Buy one, get one free! (?)
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add sterile water to dissolve the DNA: add 20 μl for 5 μg plasmid, and 100 μl for 100 μg plasmid.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

References

  • Dong H, Du L, Cai S, Lin W, Chen C, Still M, Yao Z, Coppes RP, Pan Y, Zhang D, Gao S, Zhang H. Tyrosine Phosphatase PTPRO Deficiency in ERBB2-Positive Breast Cancer Contributes to Poor Prognosis and Lapatinib Resistance. Front Pharmacol. 2022 Apr 1;13:838171.

FUGW vector (Cat. No.: V012407) Sequence

LOCUS       V012407                 9955 bp    DNA     circular SYN 05-AUG-2018
DEFINITION  Exported.
ACCESSION   V012407
VERSION     V012407
KEYWORDS    fugw
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 9955)
  AUTHORS   Lois C, Hong EJ, Pease S, Brown EJ, Baltimore D
  TITLE     Germline transmission and tissue-specific expression of transgenes
            delivered by lentiviral vectors.
  JOURNAL   Science. 2002 Feb 1. 295(5556):868-72.
   PUBMED   11786607
REFERENCE   2  (bases 1 to 9955)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Science.
            2002 Feb 1. 295(5556):868-72."
FEATURES             Location/Qualifiers
     source          1..9955
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     enhancer        238..617
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        618..820
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     LTR             835..1015
                     /label="5' LTR (truncated)"
                     /note="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    1062..1187
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    1680..1913
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             2098..2142
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             2291..2332
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    2440..2557
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        2622..3833
                     /label="UbC promoter"
                     /note="human ubiquitin C promoter"
     CDS             3887..4603
                     /label="EGFP"
                     /note="enhanced GFP"
     misc_feature    4647..5235
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     primer_bind     complement(5238..5254)
                     /label="KS primer"
                     /note="KS primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     LTR             5760..5940
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     polyA_signal    5972..6196
                     /label="bGH poly(A) signal"
                     /note="bovine growth hormone polyadenylation signal"
     rep_origin      6242..6670
                     /label="f1 ori"
                     /note="f1 bacteriophage origin of replication; arrow
                     indicates direction of (+) strand synthesis"
     promoter        6684..7013
                     /label="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     promoter        7061..7108
                     /label="EM7 promoter"
                     /note="synthetic bacterial promoter"
     CDS             7127..7498
                     /label="BleoR"
                     /note="antibiotic-binding protein"
     polyA_signal    7631..7764
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     primer_bind     complement(7801..7817)
                     /label="M13 rev"
                     /note="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     protein_bind    7825..7841
                     /label="lac repressor encoded by lacI binding site"
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="lac operator"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(7849..7879)
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(7894..7915)
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     rep_origin      complement(8203..8791)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(8965..9822)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(9823..9927)
                     /label="AmpR promoter"