pLNCX2 ER:ras vector (V012423)

Price Information

Cat No. Plasmid Name Availability Add to cart
V012423 pLNCX2 ER:ras In stock, 1 week for quality controls

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
pLNCX2 ER:ras
Antibiotic Resistance:
Ampicillin
Length:
7715 bp
Type:
Mammalian Expression
Replication origin:
ori
Selection Marker:
Neomycin (select with G418)
Copy Number:
High Copy
Promoter:
CMV
Cloning Method:
Restriction Enzyme
5' Primer:
AGCTCGTTTAGTGAACCGTCAGATC
3' Primer:
ACCTACAGGTGGGGTCTTTCATTCCC

pLNCX2 ER:ras vector Vector Map

pLNCX2 ER:ras7715 bp30060090012001500180021002400270030003300360039004200450048005100540057006000630066006900720075005' LTRMMLV Psigag (truncated)NeoR/KanRCMV enhancerCMV promoterEstrogen receptorH-Ras (G12V)LTRpGEX 3'bomL4440oriAmpRAmpR promoterpBRforEco

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

pLNCX2 ER:ras vector Sequence

Copy Sequence

Download GeneBank File(.gb)

LOCUS       V012423                 7715 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V012423
VERSION     V012423
KEYWORDS    pLNCX2 ER:ras
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 7715)
  AUTHORS   Young AR, Narita M, Ferreira M, Kirschner K, Sadaie M, Darot JF,
            Tavare S, Arakawa S, Shimizu S, Watt FM, Narita M
  TITLE     Autophagy mediates the mitotic senescence transition.
  JOURNAL   Genes Dev. 2009 Apr 1;23(7):798-803. doi: 10.1101/gad.519709. Epub
            2009 Mar 11.
   PUBMED   19279323
REFERENCE   2  (bases 1 to 7715)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 7715)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; doi:
            "10.1101/gad.519709"; journalName: "Genes Dev"; date: "2009-04-1-
            1"; volume: "23"; issue: "7"; pages: "798-803"
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..7715
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     LTR             2..589
                     /label="5' LTR"
                     /note="long terminal repeat from Moloney murine sarcoma
                     virus"
     misc_feature    652..851
                     /label="MMLV Psi"
                     /note="packaging signal of Moloney murine leukemia virus
                     (MMLV)"
     CDS             1052..1468
                     /label="gag (truncated)"
                     /note="truncated Moloney murine leukemia virus (MMLV) gag
                     gene lacking the start codon"
     CDS             1512..2303
                     /label="NeoR/KanR"
                     /note="aminoglycoside phosphotransferase"
     enhancer        2378..2681
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        2682..2885
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     CDS             3337..3699
                     /gene="ESR1"
                     /label="Estrogen receptor"
                     /note="Estrogen receptor from Macaca mulatta. Accession#:
                     P49886"
     CDS             3937..4503
                     /label="H-Ras (G12V)"
                     /note="human oncoprotein generated by the G12V mutation in
                     the small GTPase H-Ras"
     LTR             4617..5210
                     /label="LTR"
                     /note="long terminal repeat from Moloney murine leukemia
                     virus"
     primer_bind     complement(5313..5335)
                     /label="pGEX 3'"
                     /note="pGEX vectors, reverse primer"
     misc_feature    5421..5561
                     /label="bom"
                     /note="basis of mobility region from pBR322"
     primer_bind     complement(5576..5593)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(5747..6335)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(6509..7366)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(7367..7471)
                     /label="AmpR promoter"
     primer_bind     7539..7557
                     /label="pBRforEco"
                     /note="pBR322 vectors, upsteam of EcoRI site, forward
                     primer"