pLNCX2 ER:ras vector (Cat. No.: V012423)
Note: The pLNCX2 ER:ras vector is designed to express a fusion protein consisting of the estrogen receptor (ER) ligand-binding domain and the ras oncogene, rendering its activity inducible by 4-hydroxytamoxifen. This construct allows for controlled activation of ras signaling pathways in a temporal and dose-dependent manner, making it a valuable tool for studying ras-mediated cellular processes and oncogenesis in mammalian cells.
- Name:
- pLNCX2 ER:ras
- Antibiotic Resistance:
- Ampicillin
- Length:
- 7714 bp
- Type:
- Mammalian Expression
- Replication origin:
- ori
- Selection Marker:
- Neomycin (select with G418)
- Copy Number:
- High Copy
- Promoter:
- CMV
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- AGCTCGTTTAGTGAACCGTCAGATC
- 3' Primer:
- ACCTACAGGTGGGGTCTTTCATTCCC
- Growth Strain(s):
- stbl3
- Growth Temperature:
- 37℃
Resources
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
References
- Young AR, Narita M, Ferreira M, Kirschner K, Sadaie M, Darot JF, Tavaré S, Arakawa S, Shimizu S, Watt FM, Narita M. Autophagy mediates the mitotic senescence transition. Genes Dev. 2009 Apr 1;23(7):798-803. doi: 10.1101/gad.519709. Epub 2009 Mar 11. PMID: 19279323; PMCID: PMC2666340.
pLNCX2 ER:ras vector (Cat. No.: V012423) Sequence
LOCUS Exported 7714 bp DNA circular SYN 20-JUL-2025
DEFINITION Exported.
ACCESSION V012423
VERSION .
KEYWORDS pLNCX2 ER:ras
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
REFERENCE 1 (bases 1 to 7714)
AUTHORS Young AR, Narita M, Ferreira M, Kirschner K, Sadaie M, Darot JF,
Tavare S, Arakawa S, Shimizu S, Watt FM, Narita M
TITLE Autophagy mediates the mitotic senescence transition.
JOURNAL Genes Dev. 2009 Apr 1;23(7):798-803. doi: 10.1101/gad.519709. Epub
2009 Mar 11.
PUBMED 19279323
REFERENCE 2 (bases 1 to 7714)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 7714)
TITLE Direct Submission
REFERENCE 4 (bases 1 to 7714)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; doi:
"10.1101/gad.519709"; journalName: "Genes Dev"; date: "2009-04-1-
1"; volume: "23"; issue: "7"
COMMENT SGRef: number: 2; type: "Journal Article"
COMMENT SGRef: number: 3; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..7714
/mol_type="other DNA"
/organism="synthetic DNA construct"
LTR 2..589
/label=5' LTR
/note="long terminal repeat from Moloney murine sarcoma
virus"
misc_feature 652..851
/label=MMLV Psi
/note="packaging signal of Moloney murine leukemia virus
(MMLV)"
CDS 1052..1468
/label=gag (truncated)
/note="truncated Moloney murine leukemia virus (MMLV) gag
gene lacking the start codon"
CDS 1512..2303
/label=NeoR/KanR
/note="aminoglycoside phosphotransferase"
enhancer 2377..2680
/label=CMV enhancer
/note="human cytomegalovirus immediate early enhancer"
promoter 2681..2884
/label=CMV promoter
/note="human cytomegalovirus (CMV) immediate early
promoter"
CDS 3336..3698
/gene="ESR1"
/label=Estrogen receptor
/note="Estrogen receptor from Macaca mulatta. Accession#:
P49886"
CDS 3936..4502
/label=H-Ras (G12V)
/note="human oncoprotein generated by the G12V mutation in
the small GTPase H-Ras"
LTR 4616..5209
/label=LTR
/note="long terminal repeat from Moloney murine leukemia
virus"
primer_bind complement(5312..5334)
/label=pGEX 3'
/note="pGEX vectors, reverse primer"
misc_feature 5420..5560
/label=bom
/note="basis of mobility region from pBR322"
primer_bind complement(5575..5592)
/label=L4440
/note="L4440 vector, forward primer"
rep_origin complement(5746..6334)
/direction=LEFT
/label=ori
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
CDS complement(6508..7365)
/label=AmpR
/note="beta-lactamase"
promoter complement(7366..7470)
/label=AmpR promoter
primer_bind 7538..7556
/label=pBRforEco
/note="pBR322 vectors, upsteam of EcoRI site, forward
primer"