Basic Vector Information
- Vector Name:
- RS511_ErbB-RASER1C-OFP
- Antibiotic Resistance:
- Ampicillin
- Length:
- 9820 bp
- Type:
- Cloning vector
- Replication origin:
- ori
- Source/Author:
- Chung HK, Zou X, Bajar BT, Brand VR
- Promoter:
- CMV
RS511_ErbB-RASER1C-OFP vector Map
RS511_ErbB-RASER1C-OFP vector Sequence
LOCUS V015478 9820 bp DNA circular SYN 18-MAY-2019 DEFINITION Exported. ACCESSION V015478 VERSION V015478 KEYWORDS . SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 9820) AUTHORS Chung HK, Zou X, Bajar BT, Brand VR, Huo Y, Alcudia JF, Ferrell JE Jr., Lin MZ. TITLE A compact synthetic pathway rewires cancer signaling to therapeutic effector release JOURNAL Science 364 (6439) (2019) PUBMED 31048459 REFERENCE 2 (bases 1 to 9820) AUTHORS Chung HK, Lin MZ. TITLE Direct Submission JOURNAL Submitted (16-APR-2019) Bioengineering, Stanford University, 269 Campus Drive, CCRS2100, Stanford, CA 94305, United States REFERENCE 3 (bases 1 to 9820) AUTHORS . TITLE Direct Submission COMMENT ##Assembly-Data-START## Sequencing Technology :: Sanger dideoxy sequencing ##Assembly-Data-END## SGRef: number: 1; type: "Journal Article"; journalName: "Science 364 (6439) (2019)" SGRef: number: 2; type: "Journal Article"; journalName: "Submitted (16-APR-2019) Bioengineering, Stanford University, 269 Campus Drive, CCRS2100, Stanford, CA 94305, United States" FEATURES Location/Qualifiers source 1..9820 /mol_type="other DNA" /organism="synthetic DNA construct" regulatory 12..564 /regulatory_class="promoter" misc_feature 67..354 /label="CAG_enhancer" /note="CAG_enhancer" misc_feature 521..541 /label="CMV_fwd_primer" /note="CMV_fwd_primer" LTR 584..764 /label="5' LTR (truncated)" /note="truncated 5' long terminal repeat (LTR) from HIV-1" misc_feature 811..936 /label="HIV-1 Psi" /note="packaging signal of human immunodeficiency virus type 1" misc_feature 1435..1668 /label="RRE" /note="The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm." CDS 1853..1897 /label="gp41 peptide" /note="antigenic peptide corresponding to amino acids 655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik et al., 2013)" CDS 2046..2087 /note="Protein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509" /label="Protein Tat" misc_feature 2195..2312 /label="cPPT/CTS" /note="central polypurine tract and central termination sequence of HIV-1" promoter 2371..2684 /label="U6 promoter" /note="RNA polymerase III promoter for mouse U6 snRNA (Das et al., 1988)" primer_bind 2701..2717 /label="KS primer" /note="common sequencing primer, one of multiple similar variants" misc_feature 2759..2792 /label="loxP" /note="loxP" enhancer 2908..3211 /label="CMV enhancer" /note="human cytomegalovirus immediate early enhancer" promoter 3212..3415 /label="CMV promoter" /note="human cytomegalovirus (CMV) immediate early promoter" primer_bind 3416..3465 /label="p1852 NheI kozak TM" /note="p1852 NheI kozak TM" misc_feature 3448..3449 /label="nonstandard type: Editing History Replacement; GGT" CDS 3612..3638 /label="HA" /note="HA (human influenza hemagglutinin) epitope tag" CDS 3864..4373 /label="CIBN" /note="N-terminal portion of the CIB1 transcription factor from Arabidopsis thaliana" misc_feature complement(4374..4403) /direction=LEFT /label="nonstandard type: primer_bind_reverse; p1853" primer_bind 4389..4425 /label="p1727" /note="p1727" misc_feature 4428..4760 /label="nonstandard type: SH2; VAV1" misc_feature 4818..4835 /label="nonstandard type: polylinker; L6" misc_feature 4872..4904 /label="nonstandard type: Substrate; substrate 4" misc_feature 4874..4904 /label="nonstandard type: Editing History Replacement; AGATGTCGTGCCATGCTCAATGGGCTCG" CDS 4914..5564 /label="mKO2" /note="monomeric Kusabira-Orange 2 fluorescent protein" misc_feature 5577..5618 /label="nonstandard type: epitope; V5" primer_bind 5577..5618 /label="p1291" /note="p1291" misc_feature 5620..5690 /label="nonstandard type: Editing History Replacement; AAAGCGGCCGCGTCGACGGGCCCGCGGAATTCCGCCCCCCCC CCCTCTCCCTCCCCCCCCCCTAACGTTACTGGCCGAAGCCGCTTGGAATAAGGCCGGT GTGCGTTTGTCTATATGTTATTTTCCACCATATTGCCGTCTTTTGGCAATGTGAGGGC CCGGAAACCTGGCCCTGTCTTCTTGACGAGCATTCCTAGGGGTCTTTCCCCTCTCGCC AAAGGAATGCAAGGTCTGTTGAATGTCGTGAAGGAAGCAGTTCCTCTGGAAGCTTCTT GAAGACAAACAACGTCTGTAGCGACCCTTTGCAGGCAGCGGAACCCCCCACCTGGCGA CAGGTGCCTCTGCGGCCAAAAGCCACGTGTATAAGATACACCTGCAAAGGCGGCACAA CCCCAGTGCCACGTTGTGAGTTGGATAGTTGTGGAAAGAGTCAAATGGCTCTCCTCAA GCGTATTCAACAAGGGGCTGAAGGATGCCCAGAAGGTACCCCATTGTATGGGATCTGA TCTGGGGCCTCGGTGCACATGCTTTACATGTGTTTAGTCGAGGTTAAAAAAACGTCTA GGCCCCCCGAACCACGGGGACGTGGTTTTCCTTTGAAAAACACGATGATAATATGGCC ACAACC" misc_feature 5628..5690 /note="T2A peptide from Thosea asigna virus capsid protein" misc_feature complement(5637..5690) /direction=LEFT /label="nonstandard type: primer_bind_reverse; p1869 T2A rev" primer_bind 5646..5705 /label="p1867 T2A PTB" /note="p1867 T2A PTB" misc_feature complement(5717..5753) /direction=LEFT /label="nonstandard type: primer_bind_reverse; p1856 SmaI PTB rev" misc_feature 6054..6074 /label="HIF1a" /note="HIF1a" CDS 6252..6275 /label="FLAG" /note="FLAG(R) epitope tag, followed by an enterokinase cleavage site" misc_feature 6312..6890 /label="nonstandard type: Protease; NS3Tprotease" misc_feature 6471..6473 /label="nonstandard type: Editing History Replacement; GCA" primer_bind 6638..6670 /label="p1278" /note="p1278" misc_feature complement(6656..6686) /direction=LEFT /label="nonstandard type: primer_bind_reverse; p1502 MreI rev" protein_bind complement(6921..6954) /label="loxP" /note="Cre-mediated recombination occurs in the 8-bp core sequence (ATGTATGC) (Shaw et al., 2021)." misc_feature 7010..7598 /label="WPRE" /note="woodchuck hepatitis virus posttranscriptional regulatory element" primer_bind complement(7601..7617) /label="KS primer" /note="common sequencing primer, one of multiple similar variants" misc_feature 7783..7804 /label="U3PPT" /note="U3PPT" misc_feature 7783..7798 /label="cPPT" /note="cPPT" misc_feature 7840..8020 /label="truncHIV-1_3_LTR" /note="truncHIV-1_3_LTR" rep_origin complement(8082..8670) /direction=LEFT /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" CDS complement(8844..9701) /label="AmpR" /note="beta-lactamase" promoter complement(9702..9806) /label="AmpR promoter"
This page is informational only.