Price Information
| Cat No. | Plasmid Name | Availability | Add to cart |
|---|---|---|---|
| V011844 | pHAGE-mt-mKeima | In stock, instant shipping |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pHAGE-mt-mKeima
- Antibiotic Resistance:
- Ampicillin
- Length:
- 7222 bp
- Type:
- Mammalian Expression, Lentiviral
- Replication origin:
- ori
- Copy Number:
- High Copy
- Promoter:
- CMV
- Cloning Method:
- Gibson Cloning
- 5' Primer:
- CGCAAATGGGCGGTAGGCGTG
- 3' Primer:
- ATAGCGTAAAAGGAGCAACA
- Growth Strain(s):
- stbl3
- Growth Temperature:
- 37℃
pHAGE-mt-mKeima vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pHAGE-mt-mKeima vector Sequence
LOCUS V011844 7222 bp DNA circular SYN 13-MAY-2021
DEFINITION Exported.
ACCESSION V011844
VERSION V011844
KEYWORDS pHAGE-mt-mKeima
SOURCE synthetic DNA construct
ORGANISM synthetic DNA construct
.
REFERENCE 1 (bases 1 to 7222)
AUTHORS Vargas JNS, Wang C, Bunker E, Hao L, Maric D, Schiavo G, Randow F,
Youle RJ
TITLE Spatiotemporal Control of ULK1 Activation by NDP52 and TBK1 during
Selective Autophagy.
JOURNAL Mol Cell. 2019 Apr 18;74(2):347-362.e6. doi:
10.1016/j.molcel.2019.02.010. Epub 2019 Mar 7.
PUBMED 30853401
REFERENCE 2 (bases 1 to 7222)
TITLE Direct Submission
REFERENCE 3 (bases 1 to 7222)
AUTHORS .
TITLE Direct Submission
COMMENT SGRef: number: 1; type: "Journal Article"; doi:
"10.1016/j.molcel.2019.02.010"; journalName: "Mol Cell"; date:
"2019-04-18- 18"; volume: "74"; issue: "2"; pages: "347-362.e6"
SGRef: number: 2; type: "Journal Article"
FEATURES Location/Qualifiers
source 1..7222
/mol_type="other DNA"
/organism="synthetic DNA construct"
misc_feature 71..188
/label="cPPT/CTS"
/note="central polypurine tract and central termination
sequence of HIV-1"
enhancer 240..543
/label="CMV enhancer"
/note="human cytomegalovirus immediate early enhancer"
promoter 544..747
/label="CMV promoter"
/note="human cytomegalovirus (CMV) immediate early
promoter"
primer_bind 744..768
/label="LNCX"
/note="Human CMV promoter, forward primer"
CDS 828..902
/codon_start=1
/product="mitochondrial presequence of human cytochrome c
oxidase subunit VIII (Rizutto et al., 1989)"
/label="COX8 presequence"
/translation="MSVLTPLLLRGLTGSARRLPVPRAK"
CDS 945..1610
/label="mKeima-Red"
/note="monomeric Keima-Red fluorescent protein, also known
as mKeima"
misc_feature 1621..2209
/label="WPRE"
/note="woodchuck hepatitis virus posttranscriptional
regulatory element"
LTR 2284..2517
/label="3' LTR (Delta-U3)"
/note="self-inactivating 3' long terminal repeat (LTR) from
HIV-1"
primer_bind complement(2636..2654)
/label="pBRforEco"
/note="pBR322 vectors, upsteam of EcoRI site, forward
primer"
promoter 2722..2826
/label="AmpR promoter"
CDS 2827..3684
/label="AmpR"
/note="beta-lactamase"
rep_origin 3858..4446
/label="ori"
/note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
replication"
primer_bind 4600..4617
/label="L4440"
/note="L4440 vector, forward primer"
primer_bind 4709..4728
/label="SV40pro-F"
/note="SV40 promoter/origin, forward primer"
protein_bind 4857..4878
/label="CAP binding site"
/note="CAP binding activates transcription in the presence
of cAMP."
promoter 4893..4923
/label="lac promoter"
/note="promoter for the E. coli lac operon"
protein_bind 4931..4947
/label="lac operator"
/note="The lac repressor binds to the lac operator to
inhibit transcription in E. coli. This inhibition can be
relieved by adding lactose or
isopropyl-beta-D-thiogalactopyranoside (IPTG)."
primer_bind 4955..4971
/label="M13 rev"
/note="common sequencing primer, one of multiple similar
variants"
primer_bind 5021..5040
/label="EBV-rev"
/note="SV40 polyA terminator, reverse primer"
LTR 5232..5865
/label="3' LTR"
/note="3' long terminal repeat (LTR) from HIV-1"
misc_feature 5912..6037
/label="HIV-1 Psi"
/note="packaging signal of human immunodeficiency virus
type 1"
misc_feature 6534..6767
/label="RRE"
/note="The Rev response element (RRE) of HIV-1 allows for
Rev-dependent mRNA export from the nucleus to the
cytoplasm."
CDS 6952..6996
/label="gp41 peptide"
/note="antigenic peptide corresponding to amino acids 655
to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
al., 2013)"
CDS 7145..7186
/note="Protein Tat from Human immunodeficiency virus type 1
group M subtype B (isolate WMJ22). Accession#: P12509"
/label="Protein Tat"