Basic Vector Information
- Vector Name:
- pMIB/V5-His C
- Antibiotic Resistance:
- Ampicillin
- Length:
- 3592 bp
- Type:
- Insect Cell Vectors
- Replication origin:
- ori
- Source/Author:
- Invitrogen (Life Technologies)
- Selection Marker:
- Blasticidin
- Copy Number:
- High copy number
- Promoter:
- OpIE-2
- 5' Primer:
- OpIE2-F: 5'd[CGCAACGATCTGGTAAACAC]3'
- Fusion Tag:
- HBM (Nterm), V5 (Cterm), His (Cterm)
pMIB/V5-His C vector Map
pMIB/V5-His C vector Sequence
LOCUS pMIB_V5-His_C. 3592 bp DNA circular SYN 01-JAN-1980 DEFINITION Insect cell vector for expression of secreted, C-terminally V5-6xHis-tagged proteins. For other reading frames, use pMIB/V5-His A or pMIB/V5-His B. ACCESSION . VERSION . KEYWORDS pMIB V5-His C SOURCE synthetic DNA construct ORGANISM synthetic DNA construct REFERENCE 1 (bases 1 to 3592) AUTHORS Invitrogen (Life Technologies) TITLE Direct Submission REFERENCE 2 (bases 1 to 3592) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article" FEATURES Location/Qualifiers source 1..3592 /mol_type="other DNA" /organism="synthetic DNA construct" promoter 1..548 /label=OpIE-2 promoter /note="strong constitutive baculovirus promoter for insect cell expression" sig_peptide 565..627 /label=melittin signal sequence /note="signal sequence from honeybee melittin" misc_feature 629..721 /label=MCS /note="MCS" /note="multiple cloning site" CDS 730..771 /label=V5 tag /note="epitope tag from simian virus 5" CDS 781..798 /label=6xHis /note="6xHis affinity tag" polyA_signal 816..945 /label=OpIE-2 poly(A) signal /note="baculovirus polyadenylation signal" rep_origin complement(1073..1661) /direction=LEFT /label=ori /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" promoter 1736..2027 /label=OpIE-1 promoter /note="moderate constitutive baculovirus promoter for insect cell expression" promoter 2053..2100 /label=EM7 promoter /note="synthetic bacterial promoter" CDS 2119..2514 /label=BSD /note="blasticidin S deaminase" CDS 2637..3494 /label=AmpR /note="beta-lactamase"
This page is informational only.