Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V010912 | pGEX-6P-1 | In stock, instant shipping |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
The pGEX-6P-1 is a bacterial vector for expressing GST fusion proteins with a PreScission protease site. For other reading frames, use pGEX-6P-2 or pGEX-6P-3.
- Vector Name:
- pGEX-6P-1
- Antibiotic Resistance:
- Ampicillin
- Length:
- 4984 bp
- Type:
- pGEX Vectors (GE Healthcare)
- Replication origin:
- ori
- Source/Author:
- GE Healthcare
- Copy Number:
- High copy number
- Promoter:
- Tac
- 5' Primer:
- GGGCTGGCAAGCCACGTTTGGTG
- 3' Primer:
- CCGGGAGCTGCATGTGTCAGAGG
- Fusion Tag:
- N-GST
- Growth Temperature:
- 37℃
pGEX-6P-1 vector Vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
References
- Huynh TN, Ren X. Producing GST-Cbx7 Fusion Proteins from Escherichia coli. Bio Protoc. 2017 Jun 20;7(12):e2333. doi: 10.21769/BioProtoc.2333. PMID: 28966944; PMCID: PMC5621756.
pGEX-6P-1 vector Sequence
LOCUS pGEX-6P-1. 4984 bp DNA circular SYN 01-JAN-1980 DEFINITION Bacterial vector for expressing GST fusion proteins with a PreScission protease site. For other reading frames, use pGEX-6P-2 or pGEX-6P-3. ACCESSION . VERSION . KEYWORDS pGEX-6P-1 SOURCE synthetic DNA construct ORGANISM synthetic DNA construct REFERENCE 1 (bases 1 to 4984) AUTHORS GE Healthcare TITLE Direct Submission REFERENCE 2 (bases 1 to 4984) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article" FEATURES Location/Qualifiers source 1..4984 /mol_type="other DNA" /organism="synthetic DNA construct" promoter 183..211 /label=tac promoter /note="strong E. coli promoter; hybrid between the trp and lac UV5 promoters" protein_bind 219..235 /label=lac operator /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." CDS 258..911 /label=GST /note="glutathione S-transferase from Schistosoma japonicum" CDS 918..941 /label=HRV 3C site /note="recognition and cleavage site for human rhinovirus 3C and PreScission proteases" misc_feature 940..981 /label=MCS /note="MCS" /note="multiple cloning site" misc_feature 986..996 /label=stop codons /note="stop codons" /note="stop codons in all three reading frames" promoter 1287..1391 /label=AmpR promoter CDS 1392..2249 /label=AmpR /note="beta-lactamase" rep_origin 2423..3011 /label=ori /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" promoter 3255..3332 /label=lacIq promoter /note="In the lacIq allele, a single base change in the promoter boosts expression of the lacI gene about 10-fold." CDS 3333..4412 /label=lacI /note="lac repressor" protein_bind 4428..4449 /label=CAP binding site /note="CAP binding activates transcription in the presence of cAMP." promoter 4464..4494 /label=lac promoter /note="promoter for the E. coli lac operon" CDS 4538..4711 /label=lacZ-alpha /note="LacZ-alpha fragment of beta-galactosidase"