Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V010912 | pGEX-6P-1 | In stock (lyophilized plasmid) |
Buy one, get one free! |
Two vials of lyophilized plasmid will be delivered, each vial is about 5µg.
Basic Vector Information
The pGEX-6P-1 is a bacterial vector for expressing GST fusion proteins with a PreScission protease site. For other reading frames, use pGEX-6P-2 or pGEX-6P-3.
- Vector Name:
- pGEX-6P-1
- Antibiotic Resistance:
- Ampicillin
- Length:
- 4984 bp
- Type:
- pGEX Vectors (GE Healthcare)
- Replication origin:
- ori
- Source/Author:
- GE Healthcare
- Copy Number:
- High copy number
- Promoter:
- Tac
- 5' Primer:
- GGGCTGGCAAGCCACGTTTGGTG
- 3' Primer:
- CCGGGAGCTGCATGTGTCAGAGG
- Fusion Tag:
- N-GST
- Growth Temperature:
- 37℃
pGEX-6P-1 vector Vector Map
Plasmid Resuspension Protocol:
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5.Store the plasmid at -20 ℃.
References
- Huynh TN, Ren X. Producing GST-Cbx7 Fusion Proteins from Escherichia coli. Bio Protoc. 2017 Jun 20;7(12):e2333. doi: 10.21769/BioProtoc.2333. PMID: 28966944; PMCID: PMC5621756.
pGEX-6P-1 vector Sequence
LOCUS pGEX-6P-1. 4984 bp DNA circular SYN 01-JAN-1980 DEFINITION Bacterial vector for expressing GST fusion proteins with a PreScission protease site. For other reading frames, use pGEX-6P-2 or pGEX-6P-3. ACCESSION . VERSION . KEYWORDS pGEX-6P-1. SOURCE synthetic DNA construct ORGANISM synthetic DNA construct REFERENCE 1 (bases 1 to 4984) AUTHORS GE Healthcare TITLE Direct Submission REFERENCE 2 (bases 1 to 4984) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article" FEATURES Location/Qualifiers source 1..4984 /mol_type="other DNA" /organism="synthetic DNA construct" promoter 183..211 /label=tac promoter /note="strong E. coli promoter; hybrid between the trp and lac UV5 promoters" protein_bind 219..235 /label=lac operator /note="The lac repressor binds to the lac operator to inhibit transcription in E. coli. This inhibition can be relieved by adding lactose or isopropyl-beta-D-thiogalactopyranoside (IPTG)." CDS 258..911 /label=GST /note="glutathione S-transferase from Schistosoma japonicum" CDS 918..941 /label=HRV 3C site /note="recognition and cleavage site for human rhinovirus 3C and PreScission proteases" misc_feature 940..981 /label=MCS /note="MCS" /note="multiple cloning site" misc_feature 986..996 /label=stop codons /note="stop codons" /note="stop codons in all three reading frames" promoter 1287..1391 /label=AmpR promoter CDS 1392..2249 /label=AmpR /note="beta-lactamase" rep_origin 2423..3011 /label=ori /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" promoter 3255..3332 /label=lacIq promoter /note="In the lacIq allele, a single base change in the promoter boosts expression of the lacI gene about 10-fold." CDS 3333..4412 /label=lacI /note="lac repressor" protein_bind 4428..4449 /label=CAP binding site /note="CAP binding activates transcription in the presence of cAMP." promoter 4464..4494 /label=lac promoter /note="promoter for the E. coli lac operon" CDS 4538..4711 /label=lacZ-alpha /note="LacZ-alpha fragment of beta-galactosidase"