Price Information
Cat No. | Plasmid Name | Availability | Add to cart |
---|---|---|---|
V012095 | pSLQ1651-sgTelomere(F+E) | In stock, 1 week for quality controls |
Buy one, get one free! |
Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.
Basic Vector Information
- Vector Name:
- pSLQ1651-sgTelomere(F+E)
- Antibiotic Resistance:
- Ampicillin
- Length:
- 8309 bp
- Type:
- Mammalian Expression, Lentiviral, CRISPR
- Replication origin:
- ori
- Selection Marker:
- Puromycin
- Copy Number:
- High Copy
- Promoter:
- mouse U6 promoter
- Cloning Method:
- Restriction Enzyme
- 5' Primer:
- atccgacgcgccatctctag
- 3' Primer:
- tgcatggcggtaatacggttatc
pSLQ1651-sgTelomere(F+E) vector Vector Map
Plasmid Protocol
1. Centrifuge at 5,000×g for 5 min.
2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.
5. Store the plasmid at -20 ℃.
6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it
General Plasmid Transform Protocol
1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.
2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.
3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.
4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.
5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.
pSLQ1651-sgTelomere(F+E) vector Sequence
LOCUS V012095 8309 bp DNA circular SYN 13-MAY-2021 DEFINITION Exported. ACCESSION V012095 VERSION V012095 KEYWORDS pSLQ1651-sgTelomere(F+E) SOURCE synthetic DNA construct ORGANISM synthetic DNA construct . REFERENCE 1 (bases 1 to 8309) AUTHORS Chen B, Gilbert LA, Cimini BA, Schnitzbauer J, Zhang W, Li GW, Park J, Blackburn EH, Weissman JS, Qi LS, Huang B TITLE Dynamic Imaging of Genomic Loci in Living Human Cells by an Optimized CRISPR/Cas System. JOURNAL Cell. 2013 Dec 19;155(7):1479-91. doi: 10.1016/j.cell.2013.12.001. PUBMED 24360272 REFERENCE 2 (bases 1 to 8309) TITLE Direct Submission REFERENCE 3 (bases 1 to 8309) AUTHORS . TITLE Direct Submission COMMENT SGRef: number: 1; type: "Journal Article"; doi: "10.1016/j.cell.2013.12"; journalName: "Cell"; date: "2013-12-19- 19"; volume: "155"; issue: "7"; pages: "1479-91" SGRef: number: 2; type: "Journal Article" FEATURES Location/Qualifiers source 1..8309 /mol_type="other DNA" /organism="synthetic DNA construct" primer_bind complement(40..59) /label="pRS-marker" /note="pRS vectors, use to sequence yeast selectable marker" enhancer 231..610 /label="CMV enhancer" /note="human cytomegalovirus immediate early enhancer" promoter 612..810 /label="CMV promoter" /note="human cytomegalovirus (CMV) immediate early promoter" LTR 828..1008 /label="5' LTR (truncated)" /note="truncated 5' long terminal repeat (LTR) from HIV-1" misc_feature 1055..1180 /label="HIV-1 Psi" /note="packaging signal of human immunodeficiency virus type 1" misc_feature 1677..1910 /label="RRE" /note="The Rev response element (RRE) of HIV-1 allows for Rev-dependent mRNA export from the nucleus to the cytoplasm." CDS 2095..2139 /label="gp41 peptide" /note="antigenic peptide corresponding to amino acids 655 to 669 of the HIV envelope protein gp41 (Lutje Hulsik et al., 2013)" CDS 2288..2329 /note="Protein Tat from Human immunodeficiency virus type 1 group M subtype B (isolate WMJ22). Accession#: P12509" /label="Protein Tat" misc_feature 2437..2554 /label="cPPT/CTS" /note="central polypurine tract and central termination sequence of HIV-1" protein_bind 2807..2840 /label="loxP" /bound_moiety="Cre recombinase" /note="Cre-mediated recombination occurs in the 8-bp core sequence (GCATACAT)." primer_bind 2844..2864 /label="mU6-F" /note="Mouse U6 promoter, forward primer" enhancer 3159..3462 /label="CMV enhancer" /note="human cytomegalovirus immediate early enhancer" promoter 3463..3666 /label="CMV promoter" /note="human cytomegalovirus (CMV) immediate early promoter" CDS 3700..4296 /label="PuroR" /note="puromycin N-acetyltransferase" CDS 4306..4359 /codon_start=1 /product="2A peptide from Thosea asigna virus capsid protein" /label="T2A" /note="Eukaryotic ribosomes fail to insert a peptide bond between the Gly and Pro residues, yielding separate polypeptides." /translation="EGRGSLLTCGDVEENPGP" CDS 4372..5079 /label="mCherry" /note="monomeric derivative of DsRed fluorescent protein (Shaner et al., 2004)" protein_bind complement(5102..5135) /label="loxP" /note="Cre-mediated recombination occurs in the 8-bp core sequence (ATGTATGC) (Shaw et al., 2021)." misc_feature 5191..5779 /label="WPRE" /note="woodchuck hepatitis virus posttranscriptional regulatory element" primer_bind complement(5782..5798) /label="KS primer" /note="common sequencing primer, one of multiple similar variants" LTR 6308..6488 /label="5' LTR (truncated)" /note="truncated 5' long terminal repeat (LTR) from HIV-1" rep_origin complement(6550..7138) /direction=LEFT /label="ori" /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of replication" CDS complement(7312..8169) /label="AmpR" /note="beta-lactamase" promoter complement(8170..8274) /label="AmpR promoter"