lenti sgRNA(MS2)_puro backbone vector (V001436)

Price Information

Cat No. Plasmid Name Availability Add to cart
V001436 lenti sgRNA(MS2)_puro backbone In stock, 1 week for quality controls

Buy one, get one free!

Two tubes of lyophilized plasmid will be delivered, each tube is about 5µg.

Basic Vector Information

Vector Name:
lenti sgRNA(MS2)_puro backbone
Antibiotic Resistance:
Ampicillin
Length:
10222 bp
Type:
Mammalian Expression, Lentiviral, CRISPR
Replication origin:
ori
Selection Marker:
Puromycin
Copy Number:
High Copy
Promoter:
EF-1α
Cloning Method:
Restriction Enzyme
5' Primer:
GAG GGC CTA TTT CCC ATG ATT CCT TCA TAT
3' Primer:
cctagaaggtccattagctgcaaagattcc

lenti sgRNA(MS2)_puro backbone vector Map

lenti sgRNA(MS2)_puro backbone10222 bp50010001500200025003000350040004500500055006000650070007500800085009000950010000SV40 promoterEM7 promoterBleoRSV40 poly(A) signalIn lacZ genelac promoterCAP binding siteL4440oriAmpRAmpR promoterpRS-markerCMV enhancerCMV promoter5' LTR (truncated)HIV-1 PsiRREgp41 peptideProtein TatcPPT/CTSU6 promoterMS2 stem loopMS2 stem loopEF-1-alpha promoterPuroRWPREpBluescriptKS5' LTR (truncated)bGH poly(A) signalF1ori-RF1ori-F

Plasmid Protocol

1. Centrifuge at 5,000×g for 5 min.

2. Carefully open the tube and add 20 μl of sterile water to dissolve the DNA.

3. Close the tube and incubate for 10 minutes at room temperature.

4. Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g.

5. Store the plasmid at -20 ℃.

6. The concentration of plasmid re-measurement sometimes differs from the nominal value, which may be due to the position of the lyophilized plasmid in the tube, the efficiency of the re-dissolution, the measurement bias, and adsorption on the wall of the tube, therefore, it is recommended to transform and extract the plasmid before using it

General Plasmid Transform Protocol

1. Take one 100μl of the competent cells and thaw it on ice for 10min, add 2μl of plasmid, then ice bath for 30min, then heat-shock it at 42℃ for 60s, do not stir, and then ice bath for 2min.

2. Add 900μl of LB liquid medium without antibiotics, and incubate at 37℃ for 45min (30℃ for 1-1.5 hours) with 180rpm shaking.

3. Centrifuge at 6000rpm for 5min, leave only 100μl of supernatant to resuspend the bacterial precipitate and spread it onto the target plasmid-resistant LB plate.

4. Invert the plate and incubate at 37℃ for 14h, or at 30℃ for 20h.

5. Pick a single colony into LB liquid medium, add the corresponding antibiotics, incubate at 220rpm for 14h, and extract the plasmid according to the experimental needs and the instructions of the plasmid extraction kit.

lenti sgRNA(MS2)_puro backbone vector Sequence

LOCUS       V001436                10222 bp    DNA     circular SYN 13-MAY-2021
DEFINITION  Exported.
ACCESSION   V001436
VERSION     V001436
KEYWORDS    lenti sgRNA(MS2)_puro backbone
SOURCE      synthetic DNA construct
  ORGANISM  synthetic DNA construct
            .
REFERENCE   1  (bases 1 to 10222)
  AUTHORS   Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena
            C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F
  TITLE     Genome-scale transcriptional activation by an engineered CRISPR-Cas9
            complex.
  JOURNAL   Nature. 2014 Dec 10. doi: 10.1038/nature14136.
   PUBMED   25494202
REFERENCE   2  (bases 1 to 10222)
  TITLE     Direct Submission
REFERENCE   3  (bases 1 to 10222)
  AUTHORS   .
  TITLE     Direct Submission
COMMENT     SGRef: number: 1; type: "Journal Article"; journalName: "Nature.
            2014 Dec 10. doi: 10.1038/nature14136."
            SGRef: number: 2; type: "Journal Article"
FEATURES             Location/Qualifiers
     source          1..10222
                     /mol_type="other DNA"
                     /organism="synthetic DNA construct"
     promoter        86..415
                     /label="SV40 promoter"
                     /note="SV40 enhancer and early promoter"
     promoter        463..510
                     /label="EM7 promoter"
                     /note="synthetic bacterial promoter"
     CDS             529..900
                     /label="BleoR"
                     /note="antibiotic-binding protein"
     polyA_signal    1033..1166
                     /label="SV40 poly(A) signal"
                     /note="SV40 polyadenylation signal"
     primer_bind     complement(1203..1219)
                     /label="M13 rev"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     primer_bind     complement(1203..1219)
                     /label="M13 Reverse"
                     /note="In lacZ gene. Also called M13-rev"
     primer_bind     complement(1216..1238)
                     /label="M13/pUC Reverse"
                     /note="In lacZ gene"
     protein_bind    1227..1243
                     /label="lac operator"
                     /bound_moiety="lac repressor encoded by lacI"
                     /note="The lac repressor binds to the lac operator to
                     inhibit transcription in E. coli. This inhibition can be
                     relieved by adding lactose or
                     isopropyl-beta-D-thiogalactopyranoside (IPTG)."
     promoter        complement(1251..1281)
                     /label="lac promoter"
                     /note="promoter for the E. coli lac operon"
     protein_bind    complement(1296..1317)
                     /label="CAP binding site"
                     /note="CAP binding activates transcription in the presence
                     of cAMP."
     primer_bind     complement(1434..1451)
                     /label="L4440"
                     /note="L4440 vector, forward primer"
     rep_origin      complement(1605..2193)
                     /direction=LEFT
                     /label="ori"
                     /note="high-copy-number ColE1/pMB1/pBR322/pUC origin of
                     replication"
     CDS             complement(2367..3224)
                     /label="AmpR"
                     /note="beta-lactamase"
     promoter        complement(3225..3329)
                     /label="AmpR promoter"
     primer_bind     complement(3404..3423)
                     /label="pRS-marker"
                     /note="pRS vectors, use to sequence yeast selectable
                     marker"
     enhancer        3595..3974
                     /label="CMV enhancer"
                     /note="human cytomegalovirus immediate early enhancer"
     promoter        3975..4177
                     /label="CMV promoter"
                     /note="human cytomegalovirus (CMV) immediate early
                     promoter"
     LTR             4192..4372
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     misc_feature    4419..4544
                     /label="HIV-1 Psi"
                     /note="packaging signal of human immunodeficiency virus
                     type 1"
     misc_feature    5037..5270
                     /label="RRE"
                     /note="The Rev response element (RRE) of HIV-1 allows for
                     Rev-dependent mRNA export from the nucleus to the
                     cytoplasm."
     CDS             5455..5499
                     /label="gp41 peptide"
                     /note="antigenic peptide corresponding to amino acids 655
                     to 669 of the HIV envelope protein gp41 (Lutje Hulsik et
                     al., 2013)"
     CDS             5648..5689
                     /note="Protein Tat from Human immunodeficiency virus type 1
                     group M subtype B (isolate WMJ22). Accession#: P12509"
                     /label="Protein Tat"
     misc_feature    5797..5914
                     /label="cPPT/CTS"
                     /note="central polypurine tract and central termination
                     sequence of HIV-1"
     promoter        5964..6204
                     /label="U6 promoter"
                     /note="RNA polymerase III promoter for human U6 snRNA"
     misc_RNA        6250..6268
                     /label="MS2 stem loop"
                     /note="stem loop that binds the bacteriophage MS2 coat
                     protein"
     misc_RNA        6320..6338
                     /label="MS2 stem loop"
                     /note="stem loop that binds the bacteriophage MS2 coat
                     protein"
     promoter        6462..7640
                     /label="EF-1-alpha promoter"
                     /note="strong constitutive promoter for human elongation
                     factor EF-1-alpha"
     CDS             7647..8243
                     /label="PuroR"
                     /note="puromycin N-acetyltransferase"
     misc_feature    8271..8859
                     /label="WPRE"
                     /note="woodchuck hepatitis virus posttranscriptional
                     regulatory element"
     primer_bind     complement(8862..8878)
                     /label="KS primer"
                     /note="common sequencing primer, one of multiple similar
                     variants"
     primer_bind     complement(8863..8879)
                     /label="pBluescriptKS"
                     /note="For pBluescript vector"
     LTR             9384..9564
                     /label="5' LTR (truncated)"
                     /note="truncated 5' long terminal repeat (LTR) from HIV-1"
     polyA_signal    9596..9820
                     /label="bGH poly(A) signal"
                     /note="bovine growth hormone polyadenylation signal"
     primer_bind     complement(9953..9972)
                     /label="F1ori-R"
                     /note="F1 origin, reverse primer"
     primer_bind     10163..10184
                     /label="F1ori-F"
                     /note="F1 origin, forward primer"