NovoPro
Cart 2
  • YBX1 Human  cDNA/ORF Clones

YBX1 Human cDNA/ORF Clones

Cat.#: 712774-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 140.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    Y-box binding protein 1
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    YBX1
  • Gene Type
    protein coding
  • Also Known as
    YB1; BP-8; CSDB; DBPB; YB-1; CBF-A; CSDA2; EFI-A; NSEP1; NSEP-1; MDR-NF1
  • Encoded Protein Alias
    nuclease-sensitive element-binding protein 1; CBF-A; CCAAT-binding transcription factor I subunit A; DNA-binding protein B; EFI-A; Y-box transcription factor; Y-box-binding protein 1; enhancer factor I subunit A; major histocompatibility complex, class II, Y box-binding protein I; nuclease sensitive element binding protein 1
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"