NovoPro
Cart 2
  • WDR19 Human  cDNA/ORF Clone

WDR19 Human cDNA/ORF Clone

Cat.#: 746542-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 954.0 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    WD repeat domain 19
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    WDR19
  • Gene Type
    protein coding
  • Also Known as
    ATD5; CED4; DYF-2; ORF26; Oseg6; PWDMP; SRTD5; IFT144; NPHP13
  • Encoded Protein Alias
    WD repeat membrane protein PWDMP; intraflagellar transport 144 homolog
  • Product Name
    WDR19(NM_001317924) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens WD repeat domain 19 (WDR19), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    3549
  • Annotation
    This variant (2) differs in its 5' UTR compared to variant 1. This variant represents translation initiation at a downstream start codon compared to variant 1; the 5'-most initiation codon, as used in variant 1, is associated with a truncated ORF that would render the transcript a candidate for nonsense-mediated decay (NMD). Leaky scanning may allow translation initiation at the downstream start codon to encode an isoform (2) that has a shorter N-terminus, compared to isoform 1.
  • siRNA

    GCCGCAUCAUGAUUGGUUUtt

    GCAUCUAUCUGGAUCACCUtt

    CUAGCACUCUCUACCCAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    WDR19(NM_025132) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens WD repeat domain 19 (WDR19), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    4029
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer isoform (1).
  • siRNA

    GCCGCAUCAUGAUUGGUUUtt

    GCAUCUAUCUGGAUCACCUtt

    CUAGCACUCUCUACCCAAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"