NovoPro
Cart 2
  • Vdac3 Rat  cDNA/ORF Clone

Vdac3 Rat cDNA/ORF Clone

Cat.#: 704272-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 140.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    voltage-dependent anion channel 3
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Vdac3
  • Gene Type
    protein coding
  • Encoded Protein Alias
    voltage-dependent anion-selective channel protein 3; VDAC-3; mitochondrial voltage dependent anion channel 3; outer mitochondrial membrane protein porin 3; rVDAC3
  • Product Name
    Vdac3(NM_031355) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus voltage-dependent anion channel 3 (Vdac3), mRNA.
  • Synonyms
  • ORF length
    852
  • siRNA

    CCAUCUACCAGAGAGUUAAtt

    GCUGGAUUGUAGAACUUCUtt

    GGUCAUGCUUAUACUGAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Vdac3(XM_006253358) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus voltage-dependent anion channel 3 (Vdac3), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    855
  • siRNA

    CCAUCUACCAGAGAGUUAAtt

    GCUGGAUUGUAGAACUUCUtt

    GGUCAUGCUUAUACUGAUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"