NovoPro
Cart 2
  • VEGFA Chicken  cDNA/ORF Clone

VEGFA Chicken cDNA/ORF Clone

Cat.#: 736902-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    vascular endothelial growth factor A
  • Organism
    Chicken
  • Entrez Gene ID
  • Gene Symbol
    VEGFA
  • Gene Type
    protein coding
  • Also Known as
    VEGF
  • Encoded Protein Alias
    VEGF-A; VPF; vascular permeability factor
  • Product Name
    VEGFA(NM_001110355) Chicken cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Gallus gallus vascular endothelial growth factor A (VEGFA), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    579
  • Annotation
    This variant (2) is lacking an in-frame, coding exon compared to transcript variant 1, resulting in a shorter isoform (2) that is missing a 24 aa segment, compared to isoform 1.
  • DataSheet:
  • FAQs:
  • Product Name
    VEGFA(NM_205042) Chicken cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Gallus gallus vascular endothelial growth factor A (VEGFA), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    651
  • Annotation
    This variant (1) encodes the longer isoform (1).
  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"