NovoPro
Cart 2
  • Vegfa Rat  cDNA/ORF Clone

Vegfa Rat cDNA/ORF Clone

Cat.#: 715933-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 5-8 days
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    vascular endothelial growth factor A
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Vegfa
  • Gene Type
    protein coding
  • Also Known as
    VPF; Vegf; VEGF-A; VEGF164
  • Encoded Protein Alias
    vascular permeability factor
  • Product Name
    Vegfa(NM_001110336) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus vascular endothelial growth factor A (Vegfa), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    258
  • Annotation
    This variant (5) differs in the 5' UTR and lacks a portion of the 5' coding region and an in-frame, internal coding exon, compared to variant 1. The resulting isoform (5) has a shorter N-terminus and lacks an internal segment, compared to isoform 1. This variant has transcript support, but the protein is predicted.
  • siRNA

    GUGUAAAUGUUCCUGCAAAtt

    CAAAGAAAGAUAGAACAAAtt

    GCAGCAUAGCAGAUGUGAAtt

    UAGCAGAUGUGAAUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Vegfa(NM_001317043) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus vascular endothelial growth factor A (Vegfa), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    642
  • Annotation
    This variant (2) is the same as NM_001287108.1; however, uses an alternative in-frame translation termination codon (nt 1654-1656), which results in a longer, C-terminally extended isoform (Vegf-Ax) compared to isoform 7. In contrast to isoform 7, which is proangiogenic, VEGF-Ax exhibits antiangiogenic activity. As the upstream UGA stop codon (nt 1585-1587) has been shown to be recoded as serine (PMID:24949972), its location in the Vegf-Ax isoform (aa 191) is denoted by an 'S'.
  • siRNA
  • DataSheet:
  • FAQs:
  • Product Name
    Vegfa(NM_001287111) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus vascular endothelial growth factor A (Vegfa), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    1050
  • Annotation
    This variant (6) lacks an in-frame, internal exon in the 3' coding region, compared to variant 1. This variant can initiate translation from non-AUG (CUG) site, and also from a downstream, in-frame AUG site. The isoform (9) represented in this RefSeq is derived from the CUG start codon and it lacks an internal segment, compared to isoform 1.
  • siRNA

    GGGAAAGGGUCAAAAACGAtt

    CCCAUGAAGUGGUGAAGUUtt

    CAAAGAAAGAUAGAACAAAtt

    GCAGCAUAGCAGAUGUGAAtt

    UAGCAGAUGUGAAUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Vegfa(NM_001110334) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus vascular endothelial growth factor A (Vegfa), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    978
  • Annotation
    This variant (3) lacks two consecutive in-frame exons in the 3' coding region, compared to variant 1. This variant can initiate translation from non-AUG (CUG) site, and also from a downstream, in-frame AUG site. The isoform (3) represented in this RefSeq is derived from the CUG start codon and it lacks an internal segment, compared to isoform 1.
  • siRNA

    CCCAUGAAGUGGUGAAGUUtt

    CAAAGAAAGAUAGAACAAAtt

    GCAGCAUAGCAGAUGUGAAtt

    UAGCAGAUGUGAAUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Vegfa(NM_001287110) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus vascular endothelial growth factor A (Vegfa), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    441
  • Annotation
    This variant (3) lacks two consecutive in-frame exons in the 3' coding region, compared to variant 1. This variant can initiate translation from non-AUG (CUG) site, and also from a downstream, in-frame AUG site. The isoform (8) represented in this RefSeq is derived from the AUG start codon and it is shorter at the N-terminus and lacks an internal segment, compared to isoform 1.
  • siRNA

    CCCAUGAAGUGGUGAAGUUtt

    CAAAGAAAGAUAGAACAAAtt

    GCAGCAUAGCAGAUGUGAAtt

    UAGCAGAUGUGAAUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Vegfa(NM_001287114) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus vascular endothelial growth factor A (Vegfa), transcript variant 8, mRNA.
  • Synonyms
  • ORF length
    315
  • Annotation
    This variant (8) lacks an internal exon in the 5' region, which results in translation initiation at a downstream AUG site, and two consecutive in-frame exons in the 3' coding region, compared to variant 1. The resulting isoform (12) is shorter at the N-terminus and lacks an internal segment, compared to isoform 1.
  • siRNA

    CAAAGAAAGAUAGAACAAAtt

    GCAGCAUAGCAGAUGUGAAtt

    UAGCAGAUGUGAAUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Vegfa(NM_001110333) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus vascular endothelial growth factor A (Vegfa), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1110
  • Annotation
    This variant (2) lacks an in-frame, internal coding exon, compared to variant 1. This variant can initiate translation from non-AUG (CUG) site, and also from a downstream, in-frame AUG site. The isoform (2) represented in this RefSeq is derived from the CUG start codon and it lacks an internal segment, compared to isoform 1.
  • siRNA

    GUGUAAAUGUUCCUGCAAAtt

    CCCAUGAAGUGGUGAAGUUtt

    CAAAGAAAGAUAGAACAAAtt

    GCAGCAUAGCAGAUGUGAAtt

    UAGCAGAUGUGAAUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Vegfa(NM_001287107) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus vascular endothelial growth factor A (Vegfa), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    645
  • Annotation
    This variant (1) represents the longest transcript. This variant can initiate translation from non-AUG (CUG) site, and also from a downstream, in-frame AUG site. The isoform (6) represented in this RefSeq is derived from the AUG start codon and it is shorter at the N-terminus, compared to isoform 1.
  • siRNA

    GGGAAAGGGUCAAAAACGAtt

    GUGUAAAUGUUCCUGCAAAtt

    CCCAUGAAGUGGUGAAGUUtt

    CAAAGAAAGAUAGAACAAAtt

    GCAGCAUAGCAGAUGUGAAtt

    UAGCAGAUGUGAAUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Vegfa(NM_031836) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus vascular endothelial growth factor A (Vegfa), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1182
  • Annotation
    This variant (1) represents the longest transcript. This variant can initiate translation from non-AUG (CUG) site, and also from a downstream, in-frame AUG site. The isoform (1) represented in this RefSeq is derived from the CUG start codon and it is the longest isoform.
  • siRNA

    GGGAAAGGGUCAAAAACGAtt

    GUGUAAAUGUUCCUGCAAAtt

    CCCAUGAAGUGGUGAAGUUtt

    CAAAGAAAGAUAGAACAAAtt

    GCAGCAUAGCAGAUGUGAAtt

    UAGCAGAUGUGAAUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Vegfa(NM_001287112) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus vascular endothelial growth factor A (Vegfa), transcript variant 6, mRNA.
  • Synonyms
  • ORF length
    513
  • Annotation
    This variant (6) lacks an in-frame, internal exon in the 3' coding region, compared to variant 1. This variant can initiate translation from non-AUG (CUG) site, and also from a downstream, in-frame AUG site. The isoform (10) represented in this RefSeq is derived from the AUG start codon and it is shorter at the N-terminus and lacks an internal segment, compared to isoform 1.
  • siRNA

    GGGAAAGGGUCAAAAACGAtt

    CCCAUGAAGUGGUGAAGUUtt

    CAAAGAAAGAUAGAACAAAtt

    GCAGCAUAGCAGAUGUGAAtt

    UAGCAGAUGUGAAUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Vegfa(NM_001287108) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus vascular endothelial growth factor A (Vegfa), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    573
  • Annotation
    This variant (2) lacks an in-frame, internal coding exon, compared to variant 1. This variant can initiate translation from non-AUG (CUG) site, and also from a downstream, in-frame AUG site. The isoform (7) represented in this RefSeq is derived from the AUG start codon and it is shorter at the N-terminus and lacks an internal segment, compared to isoform 1.
  • siRNA

    GUGUAAAUGUUCCUGCAAAtt

    CCCAUGAAGUGGUGAAGUUtt

    CAAAGAAAGAUAGAACAAAtt

    GCAGCAUAGCAGAUGUGAAtt

    UAGCAGAUGUGAAUGCAGAtt

  • DataSheet:
  • FAQs:
  • DataSheet:
  • FAQs:
  • Product Name
    Vegfa(NM_001110335) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus vascular endothelial growth factor A (Vegfa), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    330
  • Annotation
    This variant (4) differs in the 5' UTR and lacks a portion of the 5' coding region, compared to variant 1. The resulting isoform (4) has a shorter N-terminus, compared to isoform 1. This variant has transcript support, but the protein is predicted.
  • siRNA

    GGGAAAGGGUCAAAAACGAtt

    GUGUAAAUGUUCCUGCAAAtt

    CAAAGAAAGAUAGAACAAAtt

    GCAGCAUAGCAGAUGUGAAtt

    UAGCAGAUGUGAAUGCAGAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Vegfa(NM_001287113) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus vascular endothelial growth factor A (Vegfa), transcript variant 7, mRNA.
  • Synonyms
  • ORF length
    447
  • Annotation
    This variant (7) lacks an internal exon in the 5' region, which results in translation initiation at a downstream AUG site, and an in-frame, internal coding exon, compared to variant 1. The resulting isoform (11) is shorter at the N-terminus and lacks an internal segment, compared to isoform 1.
  • siRNA

    GUGUAAAUGUUCCUGCAAAtt

    CAAAGAAAGAUAGAACAAAtt

    GCAGCAUAGCAGAUGUGAAtt

    UAGCAGAUGUGAAUGCAGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-untagged
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    6223
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Hygromycin
  • Protein Tag
    None
  • Description
    All of the pEXP vectors are designed for high-level stable and transient expression in mammalian hosts. High-level stable and non-replicative transient expression can be carried out in most mammalian cells. The vectors contain the following elements:
    • Human enhanced cytomegalovirus immediate-early (CMV) promoter for high-level expression in a wide range of mammalian cells.
    • Hygromycin resistance gene for selection of mammalian cell lines.
    • A Kozak consensus sequence to enhance mammalian expression.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"