Cart 2
  • Ufl1 Rat  cDNA/ORF Clone

Ufl1 Rat cDNA/ORF Clone

Cat.#: 737464-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 408.3 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    Ufm1-specific ligase 1
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Ufl1
  • Gene Type
    protein coding
  • Also Known as
    Maxer; RGD1309308
  • Encoded Protein Alias
    E3 UFM1-protein ligase 1; EC 6.3.2.-
  • Product Name
    Ufl1(XM_006237959) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Rattus norvegicus Ufm1-specific ligase 1 (Ufl1), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2187
  • siRNA

    GCGAGAAAUUCAUCAAUGAtt

    GCAGAACGGCUAUCUAGAAtt

    GGAAGUAGUUCAUACGCUUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"