• TRPM8 Human  cDNA/ORF Clone

TRPM8 Human cDNA/ORF Clone

Cat.#: 717721-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 795.6 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    transient receptor potential cation channel subfamily M member 8
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    TRPM8
  • Gene Type
    protein coding
  • Also Known as
    TRPP8; LTRPC6
  • Encoded Protein Alias
    LTrpC-6; long transient receptor potential channel 6; short form of the TRPM8 cationic channel; transient receptor melastatin 8 variant 1; transient receptor melastatin 8 variant 2; transient receptor potential cation channel, subfamily M, member 8; transient receptor potential p8; transient receptor potential subfamily M member 8; trp-p8
  • Product Name
    TRPM8(NM_024080) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens transient receptor potential cation channel subfamily M member 8 (TRPM8), mRNA.
  • Synonyms
  • ORF length
    3315
  • siRNA

    GACUGAGAGUUGGAUCAAAtt

    GUGAGACAGUGGUACGUAAtt

    CUCCUACGCUCUAUACAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRPM8(XM_017004891) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens transient receptor potential cation channel subfamily M member 8 (TRPM8), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    3117
  • siRNA

    GACUGAGAGUUGGAUCAAAtt

    GUGAGACAGUGGUACGUAAtt

    CUCCUACGCUCUAUACAAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRPM8(XM_011511810) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens transient receptor potential cation channel subfamily M member 8 (TRPM8), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    3348
  • siRNA

    GACUGAGAGUUGGAUCAAAtt

    GUGAGACAGUGGUACGUAAtt

    CUCCUACGCUCUAUACAAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"