NovoPro
Cart 2
  • THG1L Human  cDNA/ORF Clones

THG1L Human cDNA/ORF Clones

Cat.#: 706619-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    tRNA-histidine guanylyltransferase 1 like
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    THG1L
  • Gene Type
    protein coding
  • Also Known as
    ICF45; IHG-1; hTHG1
  • Encoded Protein Alias
    probable tRNA(His) guanylyltransferase; induced by high glucose-1; interphase cytoplasmic foci protein 45
  • Product Name
    THG1L(NM_001317825) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens tRNA-histidine guanylyltransferase 1 like (THG1L), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    522
  • Annotation
    This variant (3) uses an alternate splice junction compared to variant 1. The resulting isoform (3) is shorter at the N-terminus compared to isoform 1.
  • siRNA

    ACAACAAUCUGGACUAACAtt

    GCGGAAAACCAAUUGGUUUtt

    AGGAUAUUGUGAUCGCGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    THG1L(NM_001317824) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens tRNA-histidine guanylyltransferase 1 like (THG1L), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    501
  • Annotation
    This variant (2) uses an alternate splice junction compared to variant 1. The resulting isoform (2) has a shorter and distinct N-terminus compared to isoform 1.
  • siRNA

    ACAACAAUCUGGACUAACAtt

    GCGGAAAACCAAUUGGUUUtt

    AGGAUAUUGUGAUCGCGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    THG1L(NM_017872) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens tRNA-histidine guanylyltransferase 1 like (THG1L), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    897
  • Annotation
    This variant (1) represents the longest transcript and encodes the longest isoform (1).
  • siRNA

    ACAACAAUCUGGACUAACAtt

    GCGGAAAACCAAUUGGUUUtt

    AGGAUAUUGUGAUCGCGUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    THG1L(NM_001317826) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens tRNA-histidine guanylyltransferase 1 like (THG1L), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    711
  • Annotation
    This variant (4) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (4) has a shorter and distinct N-terminus compared to isoform 1.
  • siRNA

    ACAACAAUCUGGACUAACAtt

    GCGGAAAACCAAUUGGUUUtt

    AGGAUAUUGUGAUCGCGUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"