NovoPro
Cart 2
  • TRAPPC10 Human  cDNA/ORF Clone

TRAPPC10 Human cDNA/ORF Clone

Cat.#: 748584-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 801.4 USD

Availability: 3-4 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    trafficking protein particle complex 10
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    TRAPPC10
  • Gene Type
    protein coding
  • Also Known as
    EHOC1; GT334; TMEM1; TRS30; EHOC-1; TRS130
  • Encoded Protein Alias
    TRAPP 130 kDa subunit; TRAPP subunit TMEM1; epilepsy holoprosencephaly candidate 1 protein; epilepsy holoprosencephaly candidate-1 protein; trafficking protein particle complex subunit 130; trafficking protein particle complex subunit TMEM1; transmembrane protein 1; transport protein particle subunit TMEM1
  • Product Name
    TRAPPC10(XM_011529720) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens trafficking protein particle complex 10 (TRAPPC10), transcript variant X13, mRNA.
  • Synonyms
  • ORF length
    3339
  • siRNA

    GGUUAAUAGUGAUAGUUGAtt

    CCUCUAUUGUGGACAAAAUtt

    GAACCUCUAUUGUGGACAAtt

    CUCAGGACAUUGCUUCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRAPPC10(XM_011529730) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens trafficking protein particle complex 10 (TRAPPC10), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    2658
  • siRNA

    GGUUAAUAGUGAUAGUUGAtt

    CCUCUAUUGUGGACAAAAUtt

    GAACCUCUAUUGUGGACAAtt

    CUCAGGACAUUGCUUCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRAPPC10(XM_011529715) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens trafficking protein particle complex 10 (TRAPPC10), transcript variant X5, mRNA.
  • Synonyms
  • ORF length
    3768
  • siRNA

    GGUUAAUAGUGAUAGUUGAtt

    CCUCUAUUGUGGACAAAAUtt

    GAACCUCUAUUGUGGACAAtt

    CUCAGGACAUUGCUUCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRAPPC10(XM_005261168) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens trafficking protein particle complex 10 (TRAPPC10), transcript variant X7, mRNA.
  • Synonyms
  • ORF length
    3657
  • siRNA

    GGUUAAUAGUGAUAGUUGAtt

    CCUCUAUUGUGGACAAAAUtt

    GAACCUCUAUUGUGGACAAtt

    CUCAGGACAUUGCUUCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRAPPC10(NM_003274) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens trafficking protein particle complex 10 (TRAPPC10), mRNA.
  • Synonyms
  • ORF length
    3780
  • siRNA

    GGUUAAUAGUGAUAGUUGAtt

    CCUCUAUUGUGGACAAAAUtt

    GAACCUCUAUUGUGGACAAtt

    CUCAGGACAUUGCUUCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRAPPC10(XM_017028454) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens trafficking protein particle complex 10 (TRAPPC10), transcript variant X29, mRNA.
  • Synonyms
  • ORF length
    3633
  • siRNA

    GGUUAAUAGUGAUAGUUGAtt

    CCUCUAUUGUGGACAAAAUtt

    GAACCUCUAUUGUGGACAAtt

    CUCAGGACAUUGCUUCUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    TRAPPC10(XM_011529718) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens trafficking protein particle complex 10 (TRAPPC10), transcript variant X10, mRNA.
  • Synonyms
  • ORF length
    3537
  • siRNA

    GGUUAAUAGUGAUAGUUGAtt

    CCUCUAUUGUGGACAAAAUtt

    GAACCUCUAUUGUGGACAAtt

    CUCAGGACAUUGCUUCUUAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"