Cart 2
  • ELOB Human  cDNA/ORF Clone

ELOB Human cDNA/ORF Clone

Cat.#: 711835-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 267.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    elongin B
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    ELOB
  • Gene Type
    protein coding
  • Also Known as
    SIII; TCEB2
  • Encoded Protein Alias
    transcription elongation factor B polypeptide 2; RNA polymerase II transcription factor SIII p18 subunit; RNA polymerase II transcription factor SIII subunit B; SIII p18; elongin 18 kDa subunit; elongin, 18-kD subunit; elongin-B
  • Product Name
    ELOB(NM_207013) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens elongin B (ELOB), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    486
  • Annotation
    This variant (2) lacks a segment in the 3' region, resulting in a downstream stop codon, compared to variant 1. The resulting isoform (b) has a longer C-terminus, compared to isoform a.
  • siRNA

    CUUGGAUGAUGGCAAGACAtt

    GGGCAGAUGACACCUUUGAtt

    GGAUGACCAACUCUUGGAUtt

    GAAGCAGUGCCAAUGAACAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"