NovoPro
Cart 2
  • TM2D3 Human  cDNA/ORF Clones

TM2D3 Human cDNA/ORF Clones

Cat.#: 704732-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    TM2 domain containing 3
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    TM2D3
  • Gene Type
    protein coding
  • Also Known as
    BLP2
  • Encoded Protein Alias
    TM2 domain-containing protein 3; BBP-like protein 2; beta-amyloid-binding protein-like protein 2
  • Product Name
    TM2D3(NM_001308026) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens TM2 domain containing 3 (TM2D3), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    630
  • Annotation
    This variant (4) uses an alternate terminal exon compared to variant 1. The encoded isoform (d) is shorter and has a distinct C-terminus compared to isoform 1.
  • siRNA

    CAAGACUUCAAAUCCCAAAtt

    GUAUAGACUGCACAACAAAtt

    CAAUUGGACUGGAGGCUAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    TM2D3(NM_025141) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens TM2 domain containing 3 (TM2D3), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    666
  • Annotation
    This variant (2) lacks an exon within the coding region, but maintains the same reading frame, as compared to variant 1. Thus isoform b lacks an internal fragment of 26 aa compared to isoform a.
  • siRNA

    CAAGACUUCAAAUCCCAAAtt

    GUAUAGACUGCACAACAAAtt

    CAAUUGGACUGGAGGCUAUtt

  • DataSheet:
  • FAQs:
  • DataSheet:
  • FAQs:
  • Product Name
    TM2D3(NM_001307960) Human cDNA/ORF Clones
  • Accession NO.
  • Transcript Name
    Homo sapiens TM2 domain containing 3 (TM2D3), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    552
  • Annotation
    This variant (3) lacks an in-frame exon in the 5' coding region and uses an alternate terminal exon compared to variant 1. The encoded isoform (c) is shorter and has a distinct C-terminus compared to isoform a.
  • siRNA

    CAAGACUUCAAAUCCCAAAtt

    GUAUAGACUGCACAACAAAtt

    CAAUUGGACUGGAGGCUAUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"