NovoPro
Cart 2
  • THAP12 Human  cDNA/ORF Clone

THAP12 Human cDNA/ORF Clone

Cat.#: 748673-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 264.6 USD

Availability: 1 week
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    THAP domain containing 12
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    THAP12
  • Gene Type
    protein coding
  • Also Known as
    DAP4; THAP0; PRKRIR; P52rIPK
  • Encoded Protein Alias
    58 kDa interferon-induced protein kinase-interacting protein; P58IPK-regulatory protein; THAP domain-containing protein 0; death-associated protein 4; inhibitor of protein kinase PKR; p58IPK-interacting protein; protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
  • Product Name
    THAP12(NM_004705) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens THAP domain containing 12 (THAP12), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    2286
  • Annotation
    This variant (1) represents the shorter transcript.
  • siRNA

    CUGUAGAACUAGUCCUUAUtt

    GGCUUACAUUGUCUCUAGUtt

    CGAGAUAAUGCAAUACCAAtt

    UGAUGAAGGUUGAGAAUGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"