Cart 2
  • Tfam Rat  cDNA/ORF Clone

Tfam Rat cDNA/ORF Clone

Cat.#: 742308-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 181.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    transcription factor A, mitochondrial
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Tfam
  • Gene Type
    protein coding
  • Also Known as
    Mttfa
  • Encoded Protein Alias
    Transcription factor A, mitochondrial; mtTFA
  • Product Name
    Tfam(NM_031326) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus transcription factor A, mitochondrial (Tfam), mRNA.
  • Synonyms
  • ORF length
    735
  • siRNA

    CCUUCGAUUUUCUACAGAAtt

    GGGUAAUUAUCCAAAGAAAtt

    CGGUCAGCAUAUAACAUUUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"