• Tcp1 Mouse  cDNA/ORF Clone

Tcp1 Mouse cDNA/ORF Clone

Cat.#: 708929-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 261.2 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    t-complex protein 1
  • Organism
    Mouse
  • Entrez Gene ID
  • Gene Symbol
    Tcp1
  • Gene Type
    protein coding
  • Also Known as
    CCT; p63; Cct1; Ccta; TRic; Tp63; Tcp-1; c-cpn; AI528772
  • Encoded Protein Alias
    T-complex protein 1 subunit alpha; CCT-alpha; T-complex protein 1 subunit alpha A; T-complex protein 1 subunit alpha B; TCP-1-A; TCP-1-B; TCP-1-alpha; t-complex polypeptide 1; tailless complex polypeptide 1A; tailless complex polypeptide 1B
  • Product Name
    Tcp1(NM_001290712) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus t-complex protein 1 (Tcp1), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1524
  • Annotation
    This variant (2) lacks an alternate exon in the 5' coding region and initiates translation at an alternate start codon compared to variant 1. The encoded protein (isoform 2) has a distinct N-terminus and is shorter than isoform 1.
  • siRNA

    GGAACUACCUCAGUGGUAAtt

    GGAGAGUUUUAAAACGAGAtt

    GGUGAUUACUUUGCUAAUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    Tcp1(NM_013686) Mouse cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Mus musculus t-complex protein 1 (Tcp1), transcript variant 1, mRNA.
  • Synonyms
  • ORF length
    1671
  • Annotation
    This variant (1) represents the longer transcript and encodes the longer protein (isoform 1).
  • siRNA

    GGAACUACCUCAGUGGUAAtt

    GGAGAGUUUUAAAACGAGAtt

    GGUGAUUACUUUGCUAAUAtt

  • DataSheet:
  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pUC19
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    2686
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    pUC19 is a small, high-copy number E. coli plasmid cloning vector, of which multiple cloning sites as shown below. The molecule is a small double-stranded circle, 2686 base pairs in length. pUC19 encodes the N-terminal fragment of b-galactosidase (lacZa), which allows for blue/white colony screening (i.e., a-complementation), as well as a pUC origin of replication.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"