NovoPro
Cart 2
  • SUMO1 Chicken  cDNA/ORF Clone

SUMO1 Chicken cDNA/ORF Clone

Cat.#: 737903-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 122.6 USD

Availability: 1-2 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    small ubiquitin-like modifier 1
  • Organism
    Chicken
  • Entrez Gene ID
  • Gene Symbol
    SUMO1
  • Gene Type
    protein coding
  • Also Known as
    DAP1; GMP1; PIC1; SMT3; UBL1; OFC10; SENP2; SMT3C; SMT3H3; sentrin
  • Encoded Protein Alias
    GAP modifying protein 1; SMT3 homolog 3; SMT3 suppressor of mif two 3 homolog 1; SUMO-1; ubiquitin-homology domain protein PIC1; ubiquitin-like 1 (sentrin); ubiquitin-like protein SMT3C; ubiquitin-like protein UBL1
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"