• SDHC Human  cDNA/ORF Clone

SDHC Human cDNA/ORF Clone

Cat.#: 712125-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 267.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    succinate dehydrogenase complex subunit C
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    SDHC
  • Gene Type
    protein coding
  • Also Known as
    CYBL; PGL3; QPS1; SDH3; CYB560
  • Encoded Protein Alias
    succinate dehydrogenase cytochrome b560 subunit, mitochondrial; cytochrome B large subunit of complex II; integral membrane protein CII-3b; succinate dehydrgenase cytochrome b; succinate dehydrogenase 3, integral membrane subunit; succinate dehydrogenase complex, subunit C, integral membrane protein, 15kD; succinate-ubiquinone oxidoreductase cytochrome B large subunit
  • Product Name
    SDHC(NM_001035513) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens succinate dehydrogenase complex subunit C (SDHC), transcript variant 4, mRNA.
  • Synonyms
  • ORF length
    351
  • Annotation
    This variant (4, also known as delta2+3) lacks two alternate exons in the 5' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (4) is shorter than isoform 1.
  • siRNA

    AGACCAUAAUAGUGGAAAAtt

    CAGUUAUUCUCUCUCCAUAtt

    GGGAAUCAGAUAGAACUUAtt

    GCACUGAUCCACACAGCUAtt

    UCAUGUAUCAUACCUGGAAtt

    CUGGGAACUUUGAGUCUUAtt

    CCUGGAAUGGGAUCCGACAtt

  • DataSheet:
  • FAQs:
  • Product Name
    SDHC(NM_001278172) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens succinate dehydrogenase complex subunit C (SDHC), transcript variant 5, mRNA.
  • Synonyms
  • ORF length
    351
  • Annotation
    This variant (5, also known as delta 3+5), lacks two alternate exons, which results in a frameshift, compared to variant 1. The encoded isoform (5) is shorter and has a distinct C-terminus, compared to isoform 1.
  • siRNA

    AGACCAUAAUAGUGGAAAAtt

    CAGUUAUUCUCUCUCCAUAtt

    GGGAAUCAGAUAGAACUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    SDHC(NM_001035511) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens succinate dehydrogenase complex subunit C (SDHC), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    453
  • Annotation
    This variant (2, also known as delta5) lacks an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.
  • siRNA

    AGACCAUAAUAGUGGAAAAtt

    CAGUUAUUCUCUCUCCAUAtt

    GGGAAUCAGAUAGAACUUAtt

  • DataSheet:
  • FAQs:
  • Product Name
    SDHC(NM_001035512) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens succinate dehydrogenase complex subunit C (SDHC), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    408
  • Annotation
    This variant (3, also known as delta3) lacks an alternate exon in the 5' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (3) is shorter than isoform 1.
  • siRNA

    AGACCAUAAUAGUGGAAAAtt

    CAGUUAUUCUCUCUCCAUAtt

    GGGAAUCAGAUAGAACUUAtt

    GCACUGAUCCACACAGCUAtt

    UCAUGUAUCAUACCUGGAAtt

    CUGGGAACUUUGAGUCUUAtt

    CCUGGAAUGGGAUCCGACAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pEXP-Entry
  • primers
    T7: TAATACGACTCACTATAGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4919
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    Myc,FLAG
  • Description
    ORFs cloned in this vector will be expressed in mammalian cellsas a tagged protein with the C-terminal Myc-FLAG tags.
    Such clones are the best for detection and purification of the transgene using anti-Myc or anti-FLAG antibodies.
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5494
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"