Cart 2
  • SDHC Ferret  cDNA/ORF Clone

SDHC Ferret cDNA/ORF Clone

Cat.#: 700092-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 140.6 USD

Availability: In Stock
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    succinate dehydrogenase complex subunit C
  • Organism
    Ferret
  • Entrez Gene ID
  • Gene Symbol
    SDHC
  • Gene Type
    protein coding
  • Encoded Protein Alias
    succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa
  • Product Name
    SDHC(XM_004775947) Ferret cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Mustela putorius furo succinate dehydrogenase complex, subunit C, integral membrane protein, 15kDa (SDHC), mRNA.
  • Synonyms
  • ORF length
    510
  • DataSheet:
  • FAQs:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"