NovoPro
Cart 2
  • SLC19A3 Human  cDNA/ORF Clone

SLC19A3 Human cDNA/ORF Clone

Cat.#: 704330-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 296.7 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    solute carrier family 19 member 3
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    SLC19A3
  • Gene Type
    protein coding
  • Also Known as
    BBGD; THMD2; THTR2
  • Encoded Protein Alias
    thiamine transporter 2; solute carrier family 19, member 3; thTr-2
  • Product Name
    SLC19A3(XM_017005030) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 19 member 3 (SLC19A3), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1731
  • siRNA

    GAAGCAUGUAUAUUACCUAtt

    CUGUGAUUGUAGUAGAUCAtt

    GAACCAUUCCUUAUCCCAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC19A3(XM_005246874) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 19 member 3 (SLC19A3), transcript variant X9, mRNA.
  • Synonyms
  • ORF length
    1479
  • siRNA

    GAAGCAUGUAUAUUACCUAtt

    CUGUGAUUGUAGUAGAUCAtt

    GAACCAUUCCUUAUCCCAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC19A3(XM_017005031) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 19 member 3 (SLC19A3), transcript variant X2, mRNA.
  • Synonyms
  • ORF length
    1710
  • siRNA

    GAAGCAUGUAUAUUACCUAtt

    CUGUGAUUGUAGUAGAUCAtt

    GAACCAUUCCUUAUCCCAUtt

  • DataSheet:
  • FAQs:
  • Product Name
    SLC19A3(XM_011511931) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens solute carrier family 19 member 3 (SLC19A3), transcript variant X6, mRNA.
  • Synonyms
  • ORF length
    1527
  • siRNA

    GAAGCAUGUAUAUUACCUAtt

    CUGUGAUUGUAGUAGAUCAtt

    GAACCAUUCCUUAUCCCAUtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pCMV-SPORT6
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    4396
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Vector for cloning and transient mammalian cell expression of cDNAs.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"