NovoPro
Cart 2
  • MIEF2 Human  cDNA/ORF Clone

MIEF2 Human cDNA/ORF Clone

Cat.#: 716042-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 191.0 USD

Availability: 1 week
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    mitochondrial elongation factor 2
  • Organism
    Human
  • Entrez Gene ID
  • Gene Symbol
    MIEF2
  • Gene Type
    protein coding
  • Also Known as
    MID49; SMCR7
  • Encoded Protein Alias
    Smith-Magenis syndrome chromosomal region candidate gene 7 protein; Smith-Magenis syndrome chromosome region, candidate 7; mitochondrial dynamic protein MID49; mitochondrial dynamic protein of 49 kDa; mitochondrial dynamics protein of 49 kDa
  • Product Name
    MIEF2(NM_148886) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens mitochondrial elongation factor 2 (MIEF2), transcript variant 2, mRNA.
  • Synonyms
  • ORF length
    1398
  • Annotation
    This variant (2) differs in the 5' UTR and uses a distinct translational start codon, compared to variant 1. The resulting isoform (2) is longer at the N-terminus, compared to isoform 1.
  • siRNA

    UCCUUCCUUUUGAAACGAAtt

    GGCAGACAGCUGGAAGGAAtt

    GCUGUAUUCUGACUUUGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MIEF2(NM_001144900) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Homo sapiens mitochondrial elongation factor 2 (MIEF2), transcript variant 3, mRNA.
  • Synonyms
  • ORF length
    618
  • Annotation
    This variant (3) uses an alternate splice site in the 3' coding region that causes a translational frameshift, compared to variant 1. The resulting isoform (3) contains a distinct C-terminus and is shorter than isoform 1.
  • siRNA

    UCCUUCCUUUUGAAACGAAtt

    GGCAGACAGCUGGAAGGAAtt

    GCUGUAUUCUGACUUUGAAtt

  • DataSheet:
  • FAQs:
  • Product Name
    MIEF2(XM_017024190) Human cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    PREDICTED: Homo sapiens mitochondrial elongation factor 2 (MIEF2), transcript variant X1, mRNA.
  • Synonyms
  • ORF length
    1386
  • siRNA

    UCCUUCCUUUUGAAACGAAtt

    GGCAGACAGCUGGAAGGAAtt

    GCUGUAUUCUGACUUUGAAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pGEM-T
  • primers
    T7: TAATACGACTCACTATAGGG
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    3000
  • Vector Type
    Cloning Vector
  • Promoter
    lac
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    The pGEM-T is 3kb in length, and contains the amplicin resistance gene, conferring selection of the plasmid in E. coli, and the ori site which is the bacterial origin of replication. The plasmid has multiple cloning sites as shown below. The coding sequence was inserted by TA cloning. Many E. coli strains are suitable for the propagation of this vector including JM109, DH5α and TOP10.
  • Vector Name
    pOTB7
  • primers
    M13 fwd: GTAAAACGACGGCCAGT
    M13 rev: CAGGAAACAGCTATGAC
  • Vector Length
    1815
  • Vector Type
    Cloning Vector
  • Promoter
    -
  • Antibiotic Resistance
    Chloramphenicol
  • Selection Marker
    -
  • Protein Tag
    None
  • Description
    Gateway® or compatible clone with M13 forward and M13 reverse primers. Chloramphenicol resistance in bacteria.
  • Vector Name
    pOTENT-1
  • primers
    pOT-F: TAATAGTAATCAATTACGGG
    pOT-R: CCTCTACAAATGTGGTATGGC
  • Vector Length
    7510
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Kanamycin
  • Selection Marker
    Neomycin
  • Protein Tag
    FLAG, 6 His
  • Description
    ORFs cloned in this vector will be expressed in mammalian cells as a tagged protein with the C-terminal FLAG-6 His tags.
    Such clones are the best for detection and purification of the transgene using anti-FLAG or anti-His antibodies.
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"