Cart 2
  • Slc6a12 Rat  cDNA/ORF Clone

Slc6a12 Rat cDNA/ORF Clone

Cat.#: 745758-1

  • Accession#:
  • Vector:
Optional Service:

Special Price 323.4 USD

Availability: 2-3 weeks
- +

Add to cart to get an online quotation

Product Information

  • Gene name
    solute carrier family 6 member 12
  • Organism
    Rat
  • Entrez Gene ID
  • Gene Symbol
    Slc6a12
  • Gene Type
    protein coding
  • Also Known as
    BGT1; Gat1; VGAT; RNU28927
  • Encoded Protein Alias
    Betaine/GABA transporter 1; GABA transporter 1; Na(+)/Cl(-) betaine/GABA transporter; solute carrier family 6 (neurotransmitter transporter), member 12; solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12; vesicular GABA transporter
  • Product Name
    Slc6a12(NM_017335) Rat cDNA/ORF Clone
  • Accession NO.
  • Transcript Name
    Rattus norvegicus solute carrier family 6 member 12 (Slc6a12), mRNA.
  • Synonyms
  • ORF length
    1887
  • siRNA

    AUACAACAAUGUCUACAUAtt

    ACACCUCUCAAAUACAACAtt

    GAGUCUUAUUUGAACAUCUtt

    GAACUACUCAUCGACCAGAtt

  • DataSheet:
  • FAQs:
  • Vector Name
    pcDNA3.1-3xFlag
  • primers
    T7: TAATACGACTCACTATAGGG
    BGH: TAGAAGGCACAGTCGAGG
  • Vector Length
    5508
  • Vector Type
    Mammalian Expression Vector
  • Promoter
    CMV
  • Antibiotic Resistance
    Ampicillin
  • Selection Marker
    Neomycin
  • Protein Tag
    Flag
  • Description
    Mammalian vector for expressing C-terminal 3xFlag tagged proteins.

Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"